Incidental Mutation 'R1678:Atxn7'
ID188301
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Nameataxin 7
SynonymsA430107N12Rik, ataxin-7, Sca7
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13961440-14107302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14096239 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 515 (F515L)
Ref Sequence ENSEMBL: ENSMUSP00000152934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
Predicted Effect probably damaging
Transcript: ENSMUST00000022257
AA Change: F515L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: F515L

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223714
AA Change: F515L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223880
AA Change: F515L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223932
Predicted Effect unknown
Transcript: ENSMUST00000224315
AA Change: F34L
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14096324 splice site probably benign
IGL00782:Atxn7 APN 14 14096218 missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14100105 missense probably benign 0.00
IGL02828:Atxn7 APN 14 14090056 missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14100734 missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14052994 missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14100564 missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14087273 splice site probably benign
Estes_park UTSW 14 14096317 critical splice donor site probably null
Lumpy UTSW 14 14089446 nonsense probably null
Oestes_park UTSW 14 14096268 nonsense probably null
R0034:Atxn7 UTSW 14 14100846 missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14100317 missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14089465 splice site probably benign
R1169:Atxn7 UTSW 14 14095468 missense possibly damaging 0.81
R1802:Atxn7 UTSW 14 14089419 missense probably benign 0.25
R2078:Atxn7 UTSW 14 14052975 missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14013268 missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14100237 missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14100308 missense probably benign 0.00
R4230:Atxn7 UTSW 14 14100381 missense probably benign 0.00
R4588:Atxn7 UTSW 14 14096268 nonsense probably null
R4688:Atxn7 UTSW 14 14089288 missense probably benign 0.00
R4935:Atxn7 UTSW 14 14100401 missense probably benign
R5041:Atxn7 UTSW 14 14096317 critical splice donor site probably null
R5185:Atxn7 UTSW 14 14090063 missense probably benign 0.04
R5561:Atxn7 UTSW 14 14089260 missense probably benign 0.19
R5641:Atxn7 UTSW 14 14013638 missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14089446 nonsense probably null
R6549:Atxn7 UTSW 14 14013087 missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14099972 missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14095511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTTCCCCAAAACTGTCGCAGG -3'
(R):5'- AGCCAATGCCGTTTCCCATGTAG -3'

Sequencing Primer
(F):5'- AAACTGTCGCAGGCACTG -3'
(R):5'- TGCCGTTTCCCATGTAGATAAG -3'
Posted On2014-05-09