Incidental Mutation 'R1678:Srrm2'
ID188311
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23818986 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1535 (S1535P)
Ref Sequence ENSEMBL: ENSMUSP00000085993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect probably benign
Transcript: ENSMUST00000088621
AA Change: S1535P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: S1535P

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175240
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190568
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: S1631P
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: S1631P

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTTGACAGCAAATCTCGACACTC -3'
(R):5'- ACTGAAGGACTTCTTCTGCGTCTTG -3'

Sequencing Primer
(F):5'- GCTCAGTAGGTCTGGCTCATC -3'
(R):5'- AGCTCAGGAGATGATCGAGA -3'
Posted On2014-05-09