Incidental Mutation 'R1678:Napg'
ID188321
Institutional Source Beutler Lab
Gene Symbol Napg
Ensembl Gene ENSMUSG00000024581
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms2400003O04Rik, SNARE
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R1678 (G1)
Quality Score190
Status Not validated
Chromosome18
Chromosomal Location62977836-62999450 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 62984072 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025474] [ENSMUST00000150267]
Predicted Effect probably null
Transcript: ENSMUST00000025474
SMART Domains Protein: ENSMUSP00000025474
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 261 1e-30 PFAM
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137849
Predicted Effect probably null
Transcript: ENSMUST00000150267
SMART Domains Protein: ENSMUSP00000122681
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 195 6.7e-23 PFAM
low complexity region 204 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155440
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Napg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Napg APN 18 62986445 missense probably benign 0.21
IGL02728:Napg APN 18 62994304 splice site probably benign
IGL02742:Napg APN 18 62986248 missense probably damaging 0.99
R0276:Napg UTSW 18 62986963 missense probably damaging 1.00
R0277:Napg UTSW 18 62986963 missense probably damaging 1.00
R0323:Napg UTSW 18 62986963 missense probably damaging 1.00
R0325:Napg UTSW 18 62986963 missense probably damaging 1.00
R0751:Napg UTSW 18 62994338 missense probably benign 0.04
R0988:Napg UTSW 18 62983360 splice site probably benign
R1184:Napg UTSW 18 62994338 missense probably benign 0.04
R1387:Napg UTSW 18 62986212 missense possibly damaging 0.50
R1779:Napg UTSW 18 62982691 missense probably benign 0.33
R4723:Napg UTSW 18 62992492 critical splice donor site probably null
R5848:Napg UTSW 18 62994369 missense possibly damaging 0.49
R5874:Napg UTSW 18 62978020 nonsense probably null
R5973:Napg UTSW 18 62994983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTTGTTCTGTCCCACAGTGCC -3'
(R):5'- TTCTCAGATGCGGGAAACCTCACG -3'

Sequencing Primer
(F):5'- GCATGAAACTACACTGTGGC -3'
(R):5'- CTACAGGATGCTCACTGTGGTC -3'
Posted On2014-05-09