Incidental Mutation 'R1678:Dmd'
ID188323
Institutional Source Beutler Lab
Gene Symbol Dmd
Ensembl Gene ENSMUSG00000045103
Gene Namedystrophin, muscular dystrophy
SynonymsDp71, mdx, X-linked muscular dystrophy, Dp427, Duchenne muscular dystrophy, pke, dys
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R1678 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location82948870-85206141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84974762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 3067 (I3067N)
Ref Sequence ENSEMBL: ENSMUSP00000109633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114000]
Predicted Effect probably benign
Transcript: ENSMUST00000114000
AA Change: I3067N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109633
Gene: ENSMUSG00000045103
AA Change: I3067N

DomainStartEndE-ValueType
CH 17 117 5.94e-27 SMART
CH 136 235 3.83e-21 SMART
SPEC 344 448 7.39e-17 SMART
SPEC 453 557 6.49e-13 SMART
SPEC 564 668 9.73e-2 SMART
low complexity region 672 695 N/A INTRINSIC
SPEC 724 829 9.18e-13 SMART
SPEC 835 935 2.28e-1 SMART
SPEC 944 1046 9.34e-2 SMART
SPEC 1053 1155 7.99e-13 SMART
SPEC 1162 1264 7.52e-9 SMART
SPEC 1271 1368 5.53e-7 SMART
SPEC 1470 1569 7.29e-7 SMART
SPEC 1576 1677 8.29e-1 SMART
SPEC 1684 1781 1.82e-1 SMART
SPEC 1786 1875 3.48e0 SMART
SPEC 1882 1972 6.69e-2 SMART
SPEC 2000 2102 1.45e0 SMART
SPEC 2109 2209 6.15e-14 SMART
SPEC 2216 2317 8.9e-11 SMART
low complexity region 2325 2337 N/A INTRINSIC
low complexity region 2432 2444 N/A INTRINSIC
SPEC 2466 2569 1.65e-14 SMART
SPEC 2576 2678 1.2e-7 SMART
SPEC 2685 2794 9.84e-13 SMART
SPEC 2801 2923 8.38e-7 SMART
SPEC 2930 3032 1.21e-12 SMART
WW 3049 3081 1.36e-10 SMART
Pfam:EF-hand_2 3082 3200 1.7e-42 PFAM
Pfam:EF-hand_3 3204 3295 6.6e-41 PFAM
ZnF_ZZ 3300 3345 7.39e-18 SMART
coiled coil region 3488 3598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156107
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers in skeletal and cardiac muscles. The encoded protein, dystrophin, is part of the dystrophin-glycoprotein complex, which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. This protein is required for proper development and organization of myofibers as contractile units in striated muscles. Mutations in the human gene cause Duchenne and Becker Muscular Dystrophies and a form of heart disease called DMD-associated dilated cardiomyopathy. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene cause muscular dystrophy. Phenotypic variation has been observed in different backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Dmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Dmd APN X 83908372 splice site probably null
IGL00823:Dmd APN X 84425813 splice site probably null
IGL01160:Dmd APN X 83924961 missense probably damaging 1.00
IGL01285:Dmd APN X 85109984 nonsense probably null
IGL01294:Dmd APN X 84431998 splice site probably null
IGL02426:Dmd APN X 84848736 missense probably damaging 1.00
IGL02610:Dmd APN X 83664156 missense probably damaging 1.00
IGL02887:Dmd APN X 83878504 missense probably benign 0.44
IGL03268:Dmd APN X 83806208 missense probably damaging 0.98
IGL03301:Dmd APN X 83908514 missense probably damaging 1.00
R0480:Dmd UTSW X 84425738 missense probably benign 0.00
R0714:Dmd UTSW X 84309897 missense probably benign 0.00
R1296:Dmd UTSW X 83878520 missense probably damaging 1.00
R1448:Dmd UTSW X 84848700 missense probably damaging 0.97
R1714:Dmd UTSW X 83964750 missense probably benign 0.17
R1951:Dmd UTSW X 83830517 missense probably damaging 1.00
R1952:Dmd UTSW X 83830517 missense probably damaging 1.00
R1953:Dmd UTSW X 83830517 missense probably damaging 1.00
R1955:Dmd UTSW X 83878557 missense probably benign 0.10
R2072:Dmd UTSW X 84312483 missense probably benign 0.33
R2073:Dmd UTSW X 84312483 missense probably benign 0.33
R2074:Dmd UTSW X 84312483 missense probably benign 0.33
R2075:Dmd UTSW X 84312483 missense probably benign 0.33
R2118:Dmd UTSW X 84312483 missense probably benign 0.33
R2119:Dmd UTSW X 84312483 missense probably benign 0.33
R2120:Dmd UTSW X 84312483 missense probably benign 0.33
R2122:Dmd UTSW X 84312483 missense probably benign 0.33
R4398:Dmd UTSW X 83722018 missense probably benign 0.01
X0025:Dmd UTSW X 84647194 missense probably benign
Z1088:Dmd UTSW X 83878495 missense possibly damaging 0.67
Z1088:Dmd UTSW X 84575760 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCTTGATGGGCAACTGAGCAAAC -3'
(R):5'- TGTTGAGAATGAGCAACTCAGCTCC -3'

Sequencing Primer
(F):5'- CTGAGCAAACAGACCAGTATAAGTG -3'
(R):5'- CAGCTCCATAAATTCTGGACTG -3'
Posted On2014-05-09