Incidental Mutation 'R1679:4921517D22Rik'
List |< first << previous [record 28 of 1259] next >> last >|
ID188366
Institutional Source Beutler Lab
Gene Symbol 4921517D22Rik
Ensembl Gene ENSMUSG00000049902
Gene NameRIKEN cDNA 4921517D22 gene
Synonyms
MMRRC Submission 039715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1679 (G1)
Quality Score217
Status Validated
Chromosome13
Chromosomal Location59687402-59694108 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 59691598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153380 (fasta)
Gene Model
Predicted Effect probably null
Transcript: ENSMUST00000061597
Predicted Effect probably null
Transcript: ENSMUST00000225373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225788
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in 4921517D22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:4921517D22Rik APN 13 59689476 missense probably benign 0.00
IGL01516:4921517D22Rik APN 13 59690734 missense probably benign 0.00
R0395:4921517D22Rik UTSW 13 59689656 missense possibly damaging 0.94
R0579:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0664:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0757:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0758:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0777:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0779:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0814:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0870:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0872:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0873:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1062:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1064:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1151:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1152:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1285:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1339:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1358:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1359:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1360:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1361:4921517D22Rik UTSW 13 59691598 frame shift probably null
R4703:4921517D22Rik UTSW 13 59689528 missense possibly damaging 0.94
R4785:4921517D22Rik UTSW 13 59691592 missense probably benign
R4823:4921517D22Rik UTSW 13 59690904 missense probably damaging 0.99
R5054:4921517D22Rik UTSW 13 59689501 missense probably damaging 0.97
R6144:4921517D22Rik UTSW 13 59689533 missense probably damaging 0.99
R6977:4921517D22Rik UTSW 13 59691580 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACTGAAATGAAACTCCGGTGCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- TCGCCTGCATGTGGTATCAT -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'
Posted On2014-05-09