Incidental Mutation 'R1680:Spag5'
ID188439
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Namesperm associated antigen 5
SynonymsD11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78301529-78322457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78320616 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 993 (K993E)
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000102478]
Predicted Effect probably benign
Transcript: ENSMUST00000017534
SMART Domains Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 2.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045026
AA Change: K993E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: K993E

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102478
SMART Domains Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 5.5e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156039
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78304617 missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78304259 missense probably benign 0.06
IGL02066:Spag5 APN 11 78304532 missense probably benign
IGL02140:Spag5 APN 11 78315633 missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78320034 missense probably damaging 1.00
IGL02452:Spag5 APN 11 78304623 missense probably benign 0.08
IGL02658:Spag5 APN 11 78321331 nonsense probably null
boyardee UTSW 11 78313191 critical splice donor site probably null
franco UTSW 11 78314182 nonsense probably null
IGL02991:Spag5 UTSW 11 78314251 missense probably damaging 0.99
R0477:Spag5 UTSW 11 78314198 missense probably damaging 1.00
R0512:Spag5 UTSW 11 78319586 unclassified probably benign
R0535:Spag5 UTSW 11 78304728 missense probably benign 0.00
R0557:Spag5 UTSW 11 78314211 missense probably damaging 0.99
R0584:Spag5 UTSW 11 78304095 missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78313396 missense probably damaging 1.00
R0723:Spag5 UTSW 11 78319584 unclassified probably benign
R1413:Spag5 UTSW 11 78305317 nonsense probably null
R1687:Spag5 UTSW 11 78304929 missense probably benign 0.32
R1696:Spag5 UTSW 11 78321326 missense probably damaging 1.00
R1831:Spag5 UTSW 11 78314256 missense probably benign 0.08
R1866:Spag5 UTSW 11 78304455 missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78304176 missense probably benign 0.01
R4004:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4005:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4222:Spag5 UTSW 11 78304511 missense probably damaging 1.00
R4750:Spag5 UTSW 11 78320052 missense probably benign 0.00
R4771:Spag5 UTSW 11 78304766 missense probably damaging 1.00
R4928:Spag5 UTSW 11 78314373 missense probably damaging 0.97
R5360:Spag5 UTSW 11 78314762 missense probably damaging 0.99
R5366:Spag5 UTSW 11 78320326 splice site probably null
R5618:Spag5 UTSW 11 78304080 missense probably benign 0.00
R5668:Spag5 UTSW 11 78304716 missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78304146 missense probably benign 0.25
R5859:Spag5 UTSW 11 78313534 missense probably benign 0.38
R6564:Spag5 UTSW 11 78315575 missense probably damaging 1.00
R6571:Spag5 UTSW 11 78321269 missense probably damaging 1.00
R6573:Spag5 UTSW 11 78314182 nonsense probably null
R7074:Spag5 UTSW 11 78305042 critical splice donor site probably null
R7091:Spag5 UTSW 11 78313191 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCCTGCTGCAAGAGTCTAAAG -3'
(R):5'- GTCTGCTTGGAGAAGACAGGTCAAC -3'

Sequencing Primer
(F):5'- GTCTAAAGAGGAGGCCACTG -3'
(R):5'- CCCAGTACTAGTTCTCAGATAGGAAG -3'
Posted On2014-05-09