Incidental Mutation 'R1681:Samhd1'
ID188473
Institutional Source Beutler Lab
Gene Symbol Samhd1
Ensembl Gene ENSMUSG00000027639
Gene NameSAM domain and HD domain, 1
SynonymsE330031J07Rik
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1681 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location157097533-157135265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157101732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 621 (T621A)
Ref Sequence ENSEMBL: ENSMUSP00000085880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000109549] [ENSMUST00000123932]
Predicted Effect probably benign
Transcript: ENSMUST00000057725
AA Change: T621A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639
AA Change: T621A

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088523
AA Change: T621A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639
AA Change: T621A

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109549
SMART Domains Protein: ENSMUSP00000105176
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139263
AA Change: T600A
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639
AA Change: T600A

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160213
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in regulation of the innate immune response. The encoded protein is upregulated in response to viral infection and may be involved in mediation of tumor necrosis factor-alpha proinflammatory responses. Mutations in this gene have been associated with Aicardi-Goutieres syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to infection with pseudotyped HIV-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Samhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Samhd1 APN 2 157120548 missense probably damaging 1.00
IGL00903:Samhd1 APN 2 157107423 splice site probably benign
IGL01313:Samhd1 APN 2 157116401 missense probably damaging 1.00
IGL01775:Samhd1 APN 2 157114330 splice site probably benign
IGL02245:Samhd1 APN 2 157110555 missense possibly damaging 0.46
IGL02314:Samhd1 APN 2 157135028 missense probably damaging 0.98
R0390:Samhd1 UTSW 2 157114231 missense probably damaging 1.00
R0487:Samhd1 UTSW 2 157110615 missense probably damaging 1.00
R0842:Samhd1 UTSW 2 157123331 missense probably damaging 0.99
R1199:Samhd1 UTSW 2 157109461 missense probably damaging 0.99
R1775:Samhd1 UTSW 2 157107547 missense probably benign 0.16
R2859:Samhd1 UTSW 2 157106229 critical splice donor site probably null
R2903:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R2905:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R3983:Samhd1 UTSW 2 157123449 missense possibly damaging 0.81
R4432:Samhd1 UTSW 2 157104893 missense probably damaging 0.99
R4576:Samhd1 UTSW 2 157101750 missense probably damaging 1.00
R5283:Samhd1 UTSW 2 157109492 missense possibly damaging 0.70
R5741:Samhd1 UTSW 2 157112831 missense probably benign
R6021:Samhd1 UTSW 2 157120554 critical splice acceptor site probably null
R6518:Samhd1 UTSW 2 157114297 missense possibly damaging 0.62
R6818:Samhd1 UTSW 2 157107497 missense probably benign 0.04
R6924:Samhd1 UTSW 2 157109483 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAGGATCACTTTCGGGCTTTCC -3'
(R):5'- GCAGCGCAGTGCTTTTAACTCAAC -3'

Sequencing Primer
(F):5'- gcatccctacactcgcatc -3'
(R):5'- GCTCATTCGGGTGTACTGTA -3'
Posted On2014-05-09