Incidental Mutation 'R1681:Tlr4'
ID188482
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 039717-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1681 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66841105 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 712 (P712S)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048096
AA Change: P712S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: P712S

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTGTGATTGTGGTATCCACTGTAGC -3'
(R):5'- AGGGACTTCTCAACCTTCTCAAGGAC -3'

Sequencing Primer
(F):5'- GTGGTATCCACTGTAGCATTTC -3'
(R):5'- CCTTCTCAAGGACAATGAAGATG -3'
Posted On2014-05-09