Incidental Mutation 'R1681:Ap1m1'
ID188512
Institutional Source Beutler Lab
Gene Symbol Ap1m1
Ensembl Gene ENSMUSG00000003033
Gene Nameadaptor-related protein complex AP-1, mu subunit 1
Synonymsmu1A, [m]1A, Cltnm, AP47, Adtm1A
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1681 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72240018-72257385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72256122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 397 (I397L)
Ref Sequence ENSEMBL: ENSMUSP00000003117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003117] [ENSMUST00000126885]
PDB Structure
AP1 CLATHRIN ADAPTOR CORE [X-RAY DIFFRACTION]
HIV-1 Nef in complex with MHC-I cytoplasmic domain and Mu1 adaptin subunit of AP1 adaptor (second domain) [X-RAY DIFFRACTION]
HIV-1 Nef in complex with MHC-I cytoplasmic domain and Mu1 adaptin subunit of AP1 adaptor (second domain) [X-RAY DIFFRACTION]
Structural basis for recruitment and activation of the AP-1 clathrin adaptor complex by Arf1 [X-RAY DIFFRACTION]
Crystal structure of the human BST2 cytoplasmic domain and the HIV-1 Vpu cytoplasmic domain bound to the clathrin adaptor protein complex 1 (AP1) core [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003117
AA Change: I397L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003117
Gene: ENSMUSG00000003033
AA Change: I397L

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 4.6e-7 PFAM
Pfam:Adap_comp_sub 157 422 2.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126885
SMART Domains Protein: ENSMUSP00000120435
Gene: ENSMUSG00000003033

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 4 115 4.8e-7 PFAM
Pfam:Adap_comp_sub 131 181 6.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156735
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu-1 subunit of the scaffolding adapter protein complex AP-1 and is a member of the mu adaptin family. The AP-1 complex, which consists of 4 subunits (mu-adaptin, beta-prime adaptin, gamma-adaptin, and the small chain adaptin), is one of the predominant coat proteins of membrane vesicles involved in eukaryotic post-Golgi trafficking. The AP-1 complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. AP-1 complex subunit mu-1 and other mu-adaptins select cargo proteins bearing sequence-specific sorting motifs. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E13.5. Homozygous embryos display hemorrhage of the ventricles and spinal canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Duoxa2 T C 2: 122,299,162 probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Ap1m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ap1m1 APN 8 72255755 missense possibly damaging 0.53
IGL00795:Ap1m1 APN 8 72253509 missense probably damaging 1.00
IGL02165:Ap1m1 APN 8 72249809 missense probably benign 0.41
R0363:Ap1m1 UTSW 8 72252894 missense probably benign 0.22
R0363:Ap1m1 UTSW 8 72256724 unclassified probably benign
R1295:Ap1m1 UTSW 8 72251875 splice site probably null
R1784:Ap1m1 UTSW 8 72252849 missense probably benign 0.01
R1934:Ap1m1 UTSW 8 72255793 missense probably damaging 1.00
R4549:Ap1m1 UTSW 8 72240220 missense probably damaging 1.00
R4654:Ap1m1 UTSW 8 72252873 missense possibly damaging 0.94
R6003:Ap1m1 UTSW 8 72249167 missense probably damaging 1.00
R7048:Ap1m1 UTSW 8 72249798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCCTGAACCCCACACTT -3'
(R):5'- ACATGGTCACCCAGGGCACTCA -3'

Sequencing Primer
(F):5'- TTGGAGCCCCTCAAACTGTG -3'
(R):5'- GGCACTCACCCTCAGATCC -3'
Posted On2014-05-09