Incidental Mutation 'R1402:Prkch'
ID188574
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
MMRRC Submission 039464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1402 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73585389 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000152346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
Predicted Effect probably damaging
Transcript: ENSMUST00000021527
AA Change: V76A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: V76A

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119092
SMART Domains Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 597 6.67e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221153
AA Change: V76A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp8 T A 7: 123,466,639 V219E probably damaging Het
Birc6 T A 17: 74,697,533 probably benign Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Dlg5 T C 14: 24,176,608 S409G probably benign Het
Ehmt2 C T 17: 34,906,781 T607I probably benign Het
H2-T22 A T 17: 36,040,269 I307N possibly damaging Het
Itih3 T C 14: 30,908,708 D882G probably damaging Het
Kmt5c G T 7: 4,742,253 R81L possibly damaging Het
Mcm3ap C T 10: 76,477,914 probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nr1i2 A G 16: 38,252,883 S244P probably damaging Het
Pcx A G 19: 4,602,030 D101G possibly damaging Het
Thsd1 A G 8: 22,259,368 K691E possibly damaging Het
Tmprss11e G A 5: 86,715,618 T196I probably damaging Het
Trappc13 A G 13: 104,150,116 V211A probably damaging Het
Ttc37 A G 13: 76,131,414 Y655C probably damaging Het
Vav1 C A 17: 57,303,849 L472I probably benign Het
Wdr25 G A 12: 109,026,539 E459K probably damaging Het
Zdbf2 A T 1: 63,303,627 E388D possibly damaging Het
Zfp663 T C 2: 165,353,970 K110E probably benign Het
Zfp78 C A 7: 6,378,619 H223N probably damaging Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCACGATGAAGTTCAATGGC -3'
(R):5'- TCCACAAAGAGGACGGATTCCCAG -3'

Sequencing Primer
(F):5'- CTATCTGAGGGTCCGCATC -3'
(R):5'- TCGCGTCAACAGTGCAG -3'
Posted On2014-05-09