Incidental Mutation 'R1403:Cdh7'
ID188588
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 039465-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110061132 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 255 (V255I)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably benign
Transcript: ENSMUST00000027542
AA Change: V255I

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: V255I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112701
AA Change: V255I

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: V255I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172005
AA Change: V255I

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: V255I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACCAGTTAAGATAGGCATGACTCAGA -3'
(R):5'- AGGCCCTTGATGAAATGCAAAATTAGGA -3'

Sequencing Primer
(F):5'- agataggcatgactcagagtaac -3'
(R):5'- ATGAAATGCAAAATTAGGAGAAAGTC -3'
Posted On2014-05-09