Incidental Mutation 'R1403:Gak'
ID188602
Institutional Source Beutler Lab
Gene Symbol Gak
Ensembl Gene ENSMUSG00000062234
Gene Namecyclin G associated kinase
SynonymsD130045N16Rik
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108569411-108629755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108591145 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 156 (K156M)
Ref Sequence ENSEMBL: ENSMUSP00000116862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000139303] [ENSMUST00000145467] [ENSMUST00000199048]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046603
AA Change: K683I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: K683I

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 313 1.6e-49 PFAM
Pfam:Pkinase_Tyr 40 313 3e-30 PFAM
PTEN_C2 568 707 1.43e-44 SMART
low complexity region 819 833 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
DnaJ 1240 1301 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135225
SMART Domains Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137872
Predicted Effect probably damaging
Transcript: ENSMUST00000139303
AA Change: K156M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116862
Gene: ENSMUSG00000062234
AA Change: K156M

DomainStartEndE-ValueType
PTEN_C2 41 164 4.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145467
SMART Domains Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156110
AA Change: K34I
SMART Domains Protein: ENSMUSP00000115184
Gene: ENSMUSG00000062234
AA Change: K34I

DomainStartEndE-ValueType
Pfam:PTEN_C2 4 59 9.5e-14 PFAM
low complexity region 122 136 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
DnaJ 543 604 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199048
SMART Domains Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
PDB:4O38|B 23 69 3e-10 PDB
SCOP:d1koba_ 41 69 3e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200204
AA Change: K46I
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Gak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Gak APN 5 108613634 makesense probably null
IGL00768:Gak APN 5 108576654 missense probably benign
IGL01128:Gak APN 5 108592370 missense probably damaging 0.97
IGL01557:Gak APN 5 108584337 missense probably damaging 1.00
IGL02559:Gak APN 5 108584232 missense probably null 0.07
PIT4449001:Gak UTSW 5 108580925 missense probably benign 0.00
R0030:Gak UTSW 5 108613547 nonsense probably null
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1530:Gak UTSW 5 108624193 missense probably damaging 0.97
R1646:Gak UTSW 5 108602854 missense probably damaging 1.00
R1699:Gak UTSW 5 108604377 nonsense probably null
R1702:Gak UTSW 5 108606376 splice site probably null
R1732:Gak UTSW 5 108576582 missense probably benign 0.28
R1738:Gak UTSW 5 108616976 missense probably damaging 1.00
R1772:Gak UTSW 5 108606892 missense probably damaging 1.00
R1792:Gak UTSW 5 108585531 nonsense probably null
R2068:Gak UTSW 5 108570225 missense probably benign
R2137:Gak UTSW 5 108606877 splice site probably null
R2138:Gak UTSW 5 108606877 splice site probably null
R2139:Gak UTSW 5 108606877 splice site probably null
R2904:Gak UTSW 5 108624214 missense possibly damaging 0.70
R3080:Gak UTSW 5 108613602 missense possibly damaging 0.90
R3773:Gak UTSW 5 108582672 missense probably benign 0.00
R4523:Gak UTSW 5 108576566 missense probably benign 0.22
R4665:Gak UTSW 5 108582960 missense probably benign
R4703:Gak UTSW 5 108569877 missense probably damaging 0.99
R4890:Gak UTSW 5 108580876 unclassified probably benign
R4951:Gak UTSW 5 108582718 missense probably benign
R4971:Gak UTSW 5 108596806 missense probably damaging 1.00
R5328:Gak UTSW 5 108617001 missense possibly damaging 0.94
R5436:Gak UTSW 5 108592352 missense possibly damaging 0.94
R5496:Gak UTSW 5 108576617 missense probably benign 0.00
R6207:Gak UTSW 5 108625029 critical splice donor site probably null
R6359:Gak UTSW 5 108571900 missense probably damaging 1.00
R6468:Gak UTSW 5 108623336 nonsense probably null
R6682:Gak UTSW 5 108598876 missense probably damaging 1.00
R6915:Gak UTSW 5 108602950 missense probably benign 0.20
R7403:Gak UTSW 5 108613535 missense probably benign 0.00
X0064:Gak UTSW 5 108613533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATAAGGTCAGTCCAAAGGCATC -3'
(R):5'- GGCATCTTCTCTACTCACACCAAGC -3'

Sequencing Primer
(F):5'- AACTTGGGTCCTTCGTAAACTG -3'
(R):5'- CAGATTAGTTGGACCCAATCTGG -3'
Posted On2014-05-09