Incidental Mutation 'R1403:Grm1'
ID188617
Institutional Source Beutler Lab
Gene Symbol Grm1
Ensembl Gene ENSMUSG00000019828
Gene Nameglutamate receptor, metabotropic 1
SynonymsGrm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10686059-11082356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11080135 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 135 (D135G)
Ref Sequence ENSEMBL: ENSMUSP00000101190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]
Predicted Effect probably benign
Transcript: ENSMUST00000044306
AA Change: D135G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: D135G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105560
AA Change: D135G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: D135G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105561
AA Change: D135G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: D135G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156826
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Grm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
dewey UTSW 10 10719595 missense probably damaging 1.00
dingus UTSW 10 10719967 missense probably benign 0.06
donald UTSW 10 10741508 nonsense probably null
jim UTSW 10 10719805 missense probably damaging 1.00
lightness UTSW 10 11079958 missense probably damaging 1.00
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R0554:Grm1 UTSW 10 10719923 missense probably benign 0.01
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2198:Grm1 UTSW 10 10782776 missense probably damaging 1.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5152:Grm1 UTSW 10 11079875 missense probably benign 0.13
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5428:Grm1 UTSW 10 10719563 missense probably damaging 1.00
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
R7027:Grm1 UTSW 10 10719595 missense probably damaging 1.00
R7079:Grm1 UTSW 10 11079958 missense probably damaging 1.00
R7286:Grm1 UTSW 10 10689696 missense probably benign 0.19
R7352:Grm1 UTSW 10 10719493 missense probably damaging 1.00
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGATTTGTGGGATGTCGAACAGC -3'
(R):5'- TGGACGGAGATGTCATCATCGGAG -3'

Sequencing Primer
(F):5'- TCACTCCAGCAATAGGCTTC -3'
(R):5'- GATGTCATCATCGGAGCCCTC -3'
Posted On2014-05-09