Incidental Mutation 'R1403:Rnf44'
ID188624
Institutional Source Beutler Lab
Gene Symbol Rnf44
Ensembl Gene ENSMUSG00000034928
Gene Namering finger protein 44
Synonyms
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54679399-54693907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54682008 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 306 (E306K)
Ref Sequence ENSEMBL: ENSMUSP00000136732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037422] [ENSMUST00000122935] [ENSMUST00000125871] [ENSMUST00000125927] [ENSMUST00000126717] [ENSMUST00000128257] [ENSMUST00000129881] [ENSMUST00000134177] [ENSMUST00000134862] [ENSMUST00000145397] [ENSMUST00000146931] [ENSMUST00000150626] [ENSMUST00000150806] [ENSMUST00000177950]
Predicted Effect probably benign
Transcript: ENSMUST00000037422
AA Change: E306K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043974
Gene: ENSMUSG00000034928
AA Change: E306K

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123333
Predicted Effect probably damaging
Transcript: ENSMUST00000125871
AA Change: E388K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118474
Gene: ENSMUSG00000034928
AA Change: E388K

DomainStartEndE-ValueType
low complexity region 148 155 N/A INTRINSIC
low complexity region 186 195 N/A INTRINSIC
low complexity region 288 310 N/A INTRINSIC
RING 380 420 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125927
Predicted Effect probably benign
Transcript: ENSMUST00000126717
SMART Domains Protein: ENSMUSP00000116043
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 185 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128038
Predicted Effect probably damaging
Transcript: ENSMUST00000128257
AA Change: E306K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116850
Gene: ENSMUSG00000034928
AA Change: E306K

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129881
Predicted Effect probably benign
Transcript: ENSMUST00000134177
Predicted Effect possibly damaging
Transcript: ENSMUST00000134862
AA Change: E307K

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114259
Gene: ENSMUSG00000034928
AA Change: E307K

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145215
Predicted Effect probably benign
Transcript: ENSMUST00000145397
Predicted Effect probably benign
Transcript: ENSMUST00000146931
Predicted Effect probably benign
Transcript: ENSMUST00000150626
Predicted Effect possibly damaging
Transcript: ENSMUST00000150806
AA Change: E307K

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123198
Gene: ENSMUSG00000034928
AA Change: E307K

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177950
AA Change: E306K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136732
Gene: ENSMUSG00000034928
AA Change: E306K

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Rnf44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01837:Rnf44 APN 13 54682153 missense probably damaging 1.00
IGL01934:Rnf44 APN 13 54681950 missense probably damaging 0.98
IGL02629:Rnf44 APN 13 54683062 missense possibly damaging 0.89
IGL03030:Rnf44 APN 13 54681990 nonsense probably null
R1403:Rnf44 UTSW 13 54682008 missense probably damaging 0.99
R1654:Rnf44 UTSW 13 54681779 missense possibly damaging 0.82
R1745:Rnf44 UTSW 13 54682192 missense probably damaging 1.00
R3983:Rnf44 UTSW 13 54683148 missense probably damaging 1.00
R4086:Rnf44 UTSW 13 54682335 missense possibly damaging 0.77
R4893:Rnf44 UTSW 13 54681932 critical splice donor site probably null
R5907:Rnf44 UTSW 13 54682808 missense possibly damaging 0.50
R5997:Rnf44 UTSW 13 54682800 missense possibly damaging 0.50
R6250:Rnf44 UTSW 13 54682107 splice site probably null
R6519:Rnf44 UTSW 13 54681786 missense probably damaging 1.00
X0012:Rnf44 UTSW 13 54682847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGCAGGGGCTTATTGCAGGG -3'
(R):5'- CAACTGCCGTCGTATCGCTTTAAC -3'

Sequencing Primer
(F):5'- GTTGGCCTGGGAGAACAC -3'
(R):5'- CGTATCGCTTTAACCCTGACAG -3'
Posted On2014-05-09