Incidental Mutation 'R1405:Grip2'
ID188687
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Nameglutamate receptor interacting protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91761509-91827250 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 91788152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000161566] [ENSMUST00000162293] [ENSMUST00000162300]
Predicted Effect probably null
Transcript: ENSMUST00000159684
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161545
SMART Domains Protein: ENSMUSP00000125538
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
PDB:2QT5|B 42 89 3e-9 PDB
SCOP:d1lcya1 47 89 2e-7 SMART
low complexity region 103 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161566
SMART Domains Protein: ENSMUSP00000123941
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 9.96e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162293
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162300
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205964
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc138 T A 10: 58,545,117 probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91782897 missense probably benign 0.00
IGL01748:Grip2 APN 6 91764743 missense probably damaging 1.00
IGL01838:Grip2 APN 6 91764763 missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91787295 missense probably damaging 1.00
IGL02620:Grip2 APN 6 91778606 missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91788104 missense probably damaging 0.98
IGL03027:Grip2 APN 6 91778871 missense probably benign 0.02
IGL03180:Grip2 APN 6 91785761 splice site probably benign
R0265:Grip2 UTSW 6 91773792 critical splice donor site probably null
R0448:Grip2 UTSW 6 91779213 missense probably damaging 1.00
R0597:Grip2 UTSW 6 91796197 intron probably benign
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1664:Grip2 UTSW 6 91765252 missense probably damaging 1.00
R1703:Grip2 UTSW 6 91777398 missense probably damaging 1.00
R1793:Grip2 UTSW 6 91783642 missense probably benign 0.03
R1951:Grip2 UTSW 6 91783848 missense probably damaging 1.00
R2001:Grip2 UTSW 6 91779850 missense probably benign 0.00
R4730:Grip2 UTSW 6 91785712 makesense probably null
R4754:Grip2 UTSW 6 91779182 missense probably damaging 1.00
R4754:Grip2 UTSW 6 91779192 missense probably damaging 0.97
R4773:Grip2 UTSW 6 91782432 missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91773916 missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91779831 missense probably benign 0.04
R5972:Grip2 UTSW 6 91807281 missense probably benign 0.01
R6176:Grip2 UTSW 6 91779851 missense probably benign 0.00
R6188:Grip2 UTSW 6 91763533 missense probably damaging 1.00
R6289:Grip2 UTSW 6 91778871 missense probably benign 0.02
R6345:Grip2 UTSW 6 91765388 missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91780438 missense probably damaging 0.99
R6394:Grip2 UTSW 6 91787201 missense probably damaging 1.00
R6658:Grip2 UTSW 6 91786491 missense probably damaging 1.00
R7065:Grip2 UTSW 6 91783569 critical splice donor site probably null
R7074:Grip2 UTSW 6 91784708 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATGCCCTGTGGCAGACATCAAG -3'
(R):5'- CGCCAGAGCATTCCAGGTATAGTG -3'

Sequencing Primer
(F):5'- TGGCAGACATCAAGCTCCC -3'
(R):5'- CATTCCAGGTATAGTGGAACATGC -3'
Posted On2014-05-09