Incidental Mutation 'R1405:Lrrc8e'
ID188694
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Nameleucine rich repeat containing 8 family, member E
Synonyms1810049O03Rik, C87354
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4226827-4237470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4231754 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 30 (Y30H)
Ref Sequence ENSEMBL: ENSMUSP00000146637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053035] [ENSMUST00000207770]
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: Y30H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207770
AA Change: Y30H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc138 T A 10: 58,545,117 probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4235921 missense probably benign
IGL00943:Lrrc8e APN 8 4235658 missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4235080 missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4234084 missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4236141 missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4235392 missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4235429 missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4235776 missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4235733 missense probably benign
R0601:Lrrc8e UTSW 8 4235239 unclassified probably null
R1167:Lrrc8e UTSW 8 4235337 missense probably benign
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4234990 missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4234190 missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4235202 missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4234986 nonsense probably null
R2290:Lrrc8e UTSW 8 4231770 missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4234611 missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4233981 missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4235166 missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4234329 missense probably benign
R5516:Lrrc8e UTSW 8 4235818 missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4235725 missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4234798 missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4236034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTCACAGGCTTCCTCCTTCAG -3'
(R):5'- TGCCACATCCCACTCATTGTCAAG -3'

Sequencing Primer
(F):5'- GTGAAAGATAAACCTGTGCTTTGG -3'
(R):5'- CCACTCATTGTCAAGAAGGTGTG -3'
Posted On2014-05-09