Incidental Mutation 'R1405:Ccdc138'
ID188702
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Namecoiled-coil domain containing 138
Synonyms6230424H07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58497948-58576244 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 58545117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
Predicted Effect probably benign
Transcript: ENSMUST00000036576
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC163020.1 A G 7: 47,309,557 S229P possibly damaging Het
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
D6Wsu163e G A 6: 126,974,483 probably benign Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fam19a5 C T 15: 87,681,477 probably benign Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gm5828 T C 1: 16,769,544 noncoding transcript Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nav3 A T 10: 109,770,333 probably benign Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Ptp4a2 T A 4: 129,845,058 probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sptbn5 A T 2: 120,050,616 noncoding transcript Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58575715 missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58529016 splice site probably benign
IGL01012:Ccdc138 APN 10 58540915 critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58528923 missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58562030 missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58544914 splice site probably benign
IGL02652:Ccdc138 APN 10 58513079 missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58528899 splice site probably benign
IGL02934:Ccdc138 APN 10 58573580 splice site probably benign
IGL03231:Ccdc138 APN 10 58573706 missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58528360 missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58575823 missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58561967 missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58575717 missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58575720 missense probably damaging 1.00
R2032:Ccdc138 UTSW 10 58513162 missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58561937 nonsense probably null
R2350:Ccdc138 UTSW 10 58561893 splice site probably benign
R2571:Ccdc138 UTSW 10 58513222 missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58538270 missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58561997 missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58507643 critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58573655 missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58561996 missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58544995 missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58573636 missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58507572 missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58575705 missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58540819 missense probably damaging 1.00
R5963:Ccdc138 UTSW 10 58575757 missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58544968 missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58538280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTCCAACTCCCCTTTTGTGGTA -3'
(R):5'- gcctcacaccatctggctGACTTT -3'

Sequencing Primer
(F):5'- CAACTATGGCATCAACATTGAGG -3'
(R):5'- cacaccatctggctGACTTTATTTTC -3'
Posted On2014-05-09