Incidental Mutation 'R1406:Dctn4'
ID188754
Institutional Source Beutler Lab
Gene Symbol Dctn4
Ensembl Gene ENSMUSG00000024603
Gene Namedynactin 4
Synonymsp62, 1110001K06Rik, 4930547K17Rik, C130039E17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60526185-60558766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60556330 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 431 (D431E)
Ref Sequence ENSEMBL: ENSMUSP00000153008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025505] [ENSMUST00000025506] [ENSMUST00000223984]
Predicted Effect probably benign
Transcript: ENSMUST00000025505
AA Change: D424E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025505
Gene: ENSMUSG00000024603
AA Change: D424E

DomainStartEndE-ValueType
Pfam:Dynactin_p62 23 172 4.8e-24 PFAM
Pfam:Dynactin_p62 125 378 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025506
SMART Domains Protein: ENSMUSP00000025506
Gene: ENSMUSG00000024604

DomainStartEndE-ValueType
ZnF_C3H1 159 185 8.15e-6 SMART
RRM 233 301 7.94e-18 SMART
low complexity region 325 345 N/A INTRINSIC
low complexity region 366 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161544
Predicted Effect probably benign
Transcript: ENSMUST00000223984
AA Change: D431E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224671
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Dctn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Dctn4 APN 18 60544130 missense probably benign 0.12
R0040:Dctn4 UTSW 18 60544042 missense possibly damaging 0.71
R1406:Dctn4 UTSW 18 60556330 missense probably benign
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1785:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R1786:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R2035:Dctn4 UTSW 18 60538417 missense possibly damaging 0.91
R2064:Dctn4 UTSW 18 60538277 missense possibly damaging 0.60
R4020:Dctn4 UTSW 18 60538257 splice site probably benign
R4748:Dctn4 UTSW 18 60550236 missense probably damaging 1.00
R4786:Dctn4 UTSW 18 60555195 missense probably damaging 1.00
R4976:Dctn4 UTSW 18 60556392 missense probably benign 0.00
R5034:Dctn4 UTSW 18 60552884 missense probably benign 0.23
R5110:Dctn4 UTSW 18 60546315 missense probably damaging 0.96
R6210:Dctn4 UTSW 18 60546793 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACGACTGGGAGACTGTTGGTTC -3'
(R):5'- GCCATGCTGTTACTCAATGTGCAAG -3'

Sequencing Primer
(F):5'- ACTGTTGGTTCCGTTGACTTC -3'
(R):5'- CCTCCACAGGATTCAGTAGTGATG -3'
Posted On2014-05-09