Incidental Mutation 'R1652:Usf1'
ID 188759
Institutional Source Beutler Lab
Gene Symbol Usf1
Ensembl Gene ENSMUSG00000026641
Gene Name upstream transcription factor 1
Synonyms bHLHb11, upstream stimulatory factor
MMRRC Submission 039688-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R1652 (G1)
Quality Score 152
Status Not validated
Chromosome 1
Chromosomal Location 171238875-171246327 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 171245317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 243 (I243T)
Ref Sequence ENSEMBL: ENSMUSP00000128913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546] [ENSMUST00000171362]
AlphaFold Q61069
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect possibly damaging
Transcript: ENSMUST00000160486
AA Change: I243T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641
AA Change: I243T

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161241
AA Change: I243T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641
AA Change: I243T

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167546
AA Change: I243T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641
AA Change: I243T

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194029
Predicted Effect probably benign
Transcript: ENSMUST00000171362
SMART Domains Protein: ENSMUSP00000132771
Gene: ENSMUSG00000103711

DomainStartEndE-ValueType
RHOD 25 133 2.05e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutants exhibit slight behavioral abnormalities. Females exhibit barbering and some have seizures. This knockout mutation (heterozygous or homozygous) acts as an enhancer of a null mutation of Usf2, resulting in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 T A 14: 66,314,700 (GRCm39) E37V probably benign Het
Adamts7 A G 9: 90,071,697 (GRCm39) D664G probably damaging Het
Adamtsl5 A G 10: 80,178,011 (GRCm39) V256A probably benign Het
Adrb1 C T 19: 56,711,705 (GRCm39) S301L possibly damaging Het
Akap9 A G 5: 4,127,210 (GRCm39) Y3686C probably damaging Het
Ap3b2 A G 7: 81,123,147 (GRCm39) S456P probably damaging Het
Atp1a4 T C 1: 172,082,470 (GRCm39) Y124C probably damaging Het
Bdkrb1 A T 12: 105,570,502 (GRCm39) T23S probably damaging Het
Cacna1g A G 11: 94,318,230 (GRCm39) Y1468H probably damaging Het
Cep170b A G 12: 112,699,947 (GRCm39) D152G probably damaging Het
Cers4 T A 8: 4,566,908 (GRCm39) probably null Het
Cplane1 G T 15: 8,230,630 (GRCm39) R969L probably damaging Het
Cyp2t4 A T 7: 26,856,815 (GRCm39) D285V possibly damaging Het
Ddx56 A T 11: 6,217,679 (GRCm39) L14Q probably damaging Het
Dennd2d C A 3: 106,394,317 (GRCm39) R63S probably benign Het
Dnah7b T A 1: 46,214,550 (GRCm39) L1105* probably null Het
Eef1e1 A T 13: 38,840,081 (GRCm39) L75I possibly damaging Het
Eif1ad11 T A 12: 87,993,853 (GRCm39) V27E probably benign Het
Fam76b A G 9: 13,747,188 (GRCm39) S191G probably benign Het
Fat1 T A 8: 45,478,215 (GRCm39) Y2420* probably null Het
Fbxw18 T A 9: 109,519,695 (GRCm39) L270F probably benign Het
Fech T A 18: 64,591,269 (GRCm39) H385L probably benign Het
Fkbp4 A T 6: 128,413,637 (GRCm39) I2N probably damaging Het
Gda A T 19: 21,378,042 (GRCm39) M339K probably damaging Het
Gdpgp1 T A 7: 79,889,112 (GRCm39) M381K probably benign Het
Glyctk C A 9: 106,034,356 (GRCm39) V173L probably damaging Het
Gtf2ird1 G A 5: 134,424,567 (GRCm39) P393L probably damaging Het
Kat2a T C 11: 100,599,437 (GRCm39) N517D probably damaging Het
Krt84 G A 15: 101,434,398 (GRCm39) S523F possibly damaging Het
Lama1 G A 17: 68,114,841 (GRCm39) R2330Q probably damaging Het
Lamc1 C T 1: 153,125,392 (GRCm39) G597E probably damaging Het
Lekr1 A T 3: 65,591,508 (GRCm39) S82C probably benign Het
Lgi3 T C 14: 70,768,656 (GRCm39) F51S probably damaging Het
Lrba T C 3: 86,447,245 (GRCm39) S2030P probably damaging Het
Map4k5 A G 12: 69,877,201 (GRCm39) probably null Het
Mcoln2 C A 3: 145,869,390 (GRCm39) R32S possibly damaging Het
Metap1 A T 3: 138,168,151 (GRCm39) F324L probably damaging Het
Moxd2 C T 6: 40,864,337 (GRCm39) R31H probably damaging Het
Ncf4 T A 15: 78,145,234 (GRCm39) M274K possibly damaging Het
Nup205 T G 6: 35,215,901 (GRCm39) V1747G probably benign Het
Or10d3 G A 9: 39,461,591 (GRCm39) T192I probably benign Het
Or52r1c A G 7: 102,735,013 (GRCm39) D91G probably benign Het
Or5ae1 T C 7: 84,565,728 (GRCm39) V247A probably damaging Het
Pbx3 C T 2: 34,114,568 (GRCm39) G122D probably damaging Het
Plcb3 A G 19: 6,932,664 (GRCm39) F1034L probably benign Het
Ppp2r1a G A 17: 21,176,236 (GRCm39) V153I probably benign Het
Prss33 C G 17: 24,054,115 (GRCm39) M30I probably benign Het
Prss33 A T 17: 24,054,116 (GRCm39) M30K probably benign Het
R3hdm2 G A 10: 127,330,960 (GRCm39) S793N probably benign Het
Rab11fip5 C T 6: 85,325,279 (GRCm39) V343M probably damaging Het
Rere A G 4: 150,696,522 (GRCm39) probably benign Het
Rims1 G T 1: 22,363,090 (GRCm39) P52Q probably damaging Het
Scpep1 G T 11: 88,843,260 (GRCm39) S66* probably null Het
Setd2 A G 9: 110,378,932 (GRCm39) S632G probably benign Het
Shc3 A T 13: 51,626,875 (GRCm39) H129Q probably damaging Het
Slc22a20 A T 19: 6,022,970 (GRCm39) M391K probably damaging Het
Smurf1 A T 5: 144,817,474 (GRCm39) I712K probably damaging Het
Snx25 T A 8: 46,502,510 (GRCm39) I629L probably damaging Het
Supt16 A C 14: 52,414,637 (GRCm39) V425G probably benign Het
Tnik G A 3: 28,658,442 (GRCm39) V576I probably benign Het
Trcg1 A C 9: 57,152,856 (GRCm39) D551A probably damaging Het
Ubald2 A G 11: 116,325,178 (GRCm39) N15S probably damaging Het
Vmn2r19 A T 6: 123,292,656 (GRCm39) I233F possibly damaging Het
Vmn2r63 T C 7: 42,577,635 (GRCm39) N301S probably benign Het
Wdr27 A G 17: 15,137,532 (GRCm39) F419L probably benign Het
Other mutations in Usf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usf1 APN 1 171,244,843 (GRCm39) missense probably damaging 0.98
IGL01658:Usf1 APN 1 171,244,867 (GRCm39) missense possibly damaging 0.93
IGL01921:Usf1 APN 1 171,244,424 (GRCm39) missense possibly damaging 0.94
IGL02307:Usf1 APN 1 171,243,314 (GRCm39) missense probably damaging 0.99
R0661:Usf1 UTSW 1 171,245,067 (GRCm39) missense probably damaging 0.97
R1075:Usf1 UTSW 1 171,245,677 (GRCm39) missense probably benign 0.22
R2272:Usf1 UTSW 1 171,245,628 (GRCm39) missense possibly damaging 0.60
R4697:Usf1 UTSW 1 171,244,532 (GRCm39) missense possibly damaging 0.55
R4999:Usf1 UTSW 1 171,243,331 (GRCm39) missense probably damaging 0.98
R5940:Usf1 UTSW 1 171,245,347 (GRCm39) missense possibly damaging 0.95
R7430:Usf1 UTSW 1 171,245,295 (GRCm39) missense probably benign
R7863:Usf1 UTSW 1 171,245,385 (GRCm39) nonsense probably null
R7866:Usf1 UTSW 1 171,245,462 (GRCm39) missense unknown
R8966:Usf1 UTSW 1 171,245,101 (GRCm39) critical splice donor site probably null
R8972:Usf1 UTSW 1 171,245,352 (GRCm39) missense probably damaging 1.00
R9282:Usf1 UTSW 1 171,243,373 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATAACGAAGGTAGGTGGCATCCAG -3'
(R):5'- TGGCAAGTGTTTTCCAGGGACTC -3'

Sequencing Primer
(F):5'- CATCCAGGTGTGAAGCCAG -3'
(R):5'- ACTCCAAACTGGGTCAGTG -3'
Posted On 2014-05-09