Incidental Mutation 'R1652:2410089E03Rik'
ID188815
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 039688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1652 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8201146 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 969 (R969L)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably damaging
Transcript: ENSMUST00000110617
AA Change: R969L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: R969L

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130748
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 T A 14: 66,077,251 E37V probably benign Het
Adamts7 A G 9: 90,189,644 D664G probably damaging Het
Adamtsl5 A G 10: 80,342,177 V256A probably benign Het
Adrb1 C T 19: 56,723,273 S301L possibly damaging Het
Akap9 A G 5: 4,077,210 Y3686C probably damaging Het
Ap3b2 A G 7: 81,473,399 S456P probably damaging Het
Atp1a4 T C 1: 172,254,903 Y124C probably damaging Het
Bdkrb1 A T 12: 105,604,243 T23S probably damaging Het
Cacna1g A G 11: 94,427,404 Y1468H probably damaging Het
Cep170b A G 12: 112,733,513 D152G probably damaging Het
Cers4 T A 8: 4,516,908 probably null Het
Cyp2t4 A T 7: 27,157,390 D285V possibly damaging Het
Ddx56 A T 11: 6,267,679 L14Q probably damaging Het
Dennd2d C A 3: 106,487,001 R63S probably benign Het
Dnah7b T A 1: 46,175,390 L1105* probably null Het
Eef1e1 A T 13: 38,656,105 L75I possibly damaging Het
Fam76b A G 9: 13,835,892 S191G probably benign Het
Fat1 T A 8: 45,025,178 Y2420* probably null Het
Fbxw18 T A 9: 109,690,627 L270F probably benign Het
Fech T A 18: 64,458,198 H385L probably benign Het
Fkbp4 A T 6: 128,436,674 I2N probably damaging Het
Gda A T 19: 21,400,678 M339K probably damaging Het
Gdpgp1 T A 7: 80,239,364 M381K probably benign Het
Glyctk C A 9: 106,157,157 V173L probably damaging Het
Gm2056 T A 12: 88,027,083 V27E probably benign Het
Gtf2ird1 G A 5: 134,395,713 P393L probably damaging Het
Kat2a T C 11: 100,708,611 N517D probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama1 G A 17: 67,807,846 R2330Q probably damaging Het
Lamc1 C T 1: 153,249,646 G597E probably damaging Het
Lekr1 A T 3: 65,684,087 S82C probably benign Het
Lgi3 T C 14: 70,531,216 F51S probably damaging Het
Lrba T C 3: 86,539,938 S2030P probably damaging Het
Map4k5 A G 12: 69,830,427 probably null Het
Mcoln2 C A 3: 146,163,635 R32S possibly damaging Het
Metap1 A T 3: 138,462,390 F324L probably damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Ncf4 T A 15: 78,261,034 M274K possibly damaging Het
Nup205 T G 6: 35,238,966 V1747G probably benign Het
Olfr290 T C 7: 84,916,520 V247A probably damaging Het
Olfr584 A G 7: 103,085,806 D91G probably benign Het
Olfr958 G A 9: 39,550,295 T192I probably benign Het
Pbx3 C T 2: 34,224,556 G122D probably damaging Het
Plcb3 A G 19: 6,955,296 F1034L probably benign Het
Ppp2r1a G A 17: 20,955,974 V153I probably benign Het
Prss33 C G 17: 23,835,141 M30I probably benign Het
Prss33 A T 17: 23,835,142 M30K probably benign Het
R3hdm2 G A 10: 127,495,091 S793N probably benign Het
Rab11fip5 C T 6: 85,348,297 V343M probably damaging Het
Rere A G 4: 150,612,065 probably benign Het
Rims1 G T 1: 22,292,866 P52Q probably damaging Het
Scpep1 G T 11: 88,952,434 S66* probably null Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc3 A T 13: 51,472,839 H129Q probably damaging Het
Slc22a20 A T 19: 5,972,942 M391K probably damaging Het
Smurf1 A T 5: 144,880,664 I712K probably damaging Het
Snx25 T A 8: 46,049,473 I629L probably damaging Het
Supt16 A C 14: 52,177,180 V425G probably benign Het
Tnik G A 3: 28,604,293 V576I probably benign Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ubald2 A G 11: 116,434,352 N15S probably damaging Het
Usf1 T C 1: 171,417,749 I243T probably damaging Het
Vmn2r19 A T 6: 123,315,697 I233F possibly damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wdr27 A G 17: 14,917,270 F419L probably benign Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCCCCTGGTCTGGGACA -3'
(R):5'- TTCCAGTCTCCAAGTTTATGTGCCATC -3'

Sequencing Primer
(F):5'- TCATTAAGCAGTAGTCACCCTG -3'
(R):5'- AGTTTATGTGCCATCCACACAG -3'
Posted On2014-05-09