Incidental Mutation 'R1653:Nfs1'
ID188837
Institutional Source Beutler Lab
Gene Symbol Nfs1
Ensembl Gene ENSMUSG00000027618
Gene Namenitrogen fixation gene 1 (S. cerevisiae)
Synonymsm-Nfs1
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.975) question?
Stock #R1653 (G1)
Quality Score190
Status Not validated
Chromosome2
Chromosomal Location156123639-156144186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156125336 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 44 (G44D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000184469]
Predicted Effect probably damaging
Transcript: ENSMUST00000029147
AA Change: V421M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: V421M

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159952
AA Change: V67M
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950
AA Change: V67M

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160165
AA Change: G44D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950
AA Change: G44D

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162612
AA Change: V67M
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950
AA Change: V67M

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184469
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Nfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Nfs1 APN 2 156124271 missense probably damaging 1.00
IGL02944:Nfs1 APN 2 156127768 missense probably damaging 1.00
IGL03350:Nfs1 APN 2 156127740 missense probably benign 0.37
R0118:Nfs1 UTSW 2 156134524 missense probably damaging 1.00
R0374:Nfs1 UTSW 2 156132660 missense probably damaging 1.00
R3787:Nfs1 UTSW 2 156128583 missense possibly damaging 0.53
R4614:Nfs1 UTSW 2 156144050 missense probably benign 0.04
R4782:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R4799:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R5053:Nfs1 UTSW 2 156126398 missense probably damaging 0.99
R5447:Nfs1 UTSW 2 156142136 missense probably benign 0.01
R5479:Nfs1 UTSW 2 156128502 missense probably damaging 1.00
R5992:Nfs1 UTSW 2 156134453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCCTACAATCCCTTTACACTCGG -3'
(R):5'- ACCTCCTGTTTACCTAGAGAGGCAC -3'

Sequencing Primer
(F):5'- GGGTTTCCGGCTGTATGAAC -3'
(R):5'- gtagccagagaatgcccc -3'
Posted On2014-05-09