Incidental Mutation 'R1653:Crmp1'
ID188845
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Namecollapsin response mediator protein 1
SynonymsUlip3, DRP-1
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location37241940-37292133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37286468 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 575 (V575D)
Ref Sequence ENSEMBL: ENSMUSP00000109795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114154] [ENSMUST00000114158]
Predicted Effect probably damaging
Transcript: ENSMUST00000031004
AA Change: V461D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121
AA Change: V461D

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114154
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114158
AA Change: V575D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: V575D

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201765
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37276313 missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37278855 splice site probably benign
IGL02904:Crmp1 APN 5 37288918 missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37284080 missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37286426 missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37265289 missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37265313 missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37273434 missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37288811 missense probably benign 0.14
R1651:Crmp1 UTSW 5 37273439 missense probably damaging 0.97
R1951:Crmp1 UTSW 5 37273355 missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37276283 missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37242494 missense probably benign 0.04
R2295:Crmp1 UTSW 5 37265262 missense probably benign
R2495:Crmp1 UTSW 5 37246097 critical splice donor site probably null
R3417:Crmp1 UTSW 5 37268687 missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37284140 missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37276331 missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37279674 missense probably benign 0.16
R5592:Crmp1 UTSW 5 37265265 missense probably benign 0.09
R5761:Crmp1 UTSW 5 37282868 missense probably benign 0.15
R6243:Crmp1 UTSW 5 37288944 missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37284064 missense probably benign 0.04
R6750:Crmp1 UTSW 5 37265322 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAACCCTGGCTGTGGTACAGAAG -3'
(R):5'- TGGGCTATGTGAGGAACCTCCAAG -3'

Sequencing Primer
(F):5'- CTGGCTGTGGTACAGAAGTAACTC -3'
(R):5'- TGTCTGGTCTCAGATGAACAC -3'
Posted On2014-05-09