Incidental Mutation 'R1653:Ccser1'
ID188849
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61311465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 204 (I204K)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
Predicted Effect probably benign
Transcript: ENSMUST00000045522
AA Change: I204K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: I204K

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126214
AA Change: I204K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: I204K

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAAGACACTCTGTGGGTTTCAGC -3'
(R):5'- GGAAAGGCATCTGCCTCAGACAAAG -3'

Sequencing Primer
(F):5'- GGTTTCAGCAGTTCACGAAG -3'
(R):5'- CTTCAGTCAAGGCCAAAAATTCTG -3'
Posted On2014-05-09