Incidental Mutation 'R1654:Ndufaf5'
ID188908
Institutional Source Beutler Lab
Gene Symbol Ndufaf5
Ensembl Gene ENSMUSG00000027384
Gene NameNADH dehydrogenase (ubiquinone) complex I, assembly factor 5
Synonyms
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location140170649-140203689 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 140177300 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825]
Predicted Effect probably null
Transcript: ENSMUST00000044825
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125913
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes a mitochondrial protein that is associated with the matrix face of the mitochondrial inner membrane and is required for complex I assembly. A mutation in this gene results in mitochondrial complex I deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Ndufaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Ndufaf5 APN 2 140188743 missense probably benign 0.01
R0373:Ndufaf5 UTSW 2 140170881 missense probably benign 0.03
R1710:Ndufaf5 UTSW 2 140193602 missense possibly damaging 0.92
R1868:Ndufaf5 UTSW 2 140181589 missense probably benign 0.00
R2226:Ndufaf5 UTSW 2 140188860 missense probably benign 0.02
R3794:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R4440:Ndufaf5 UTSW 2 140170725 missense probably benign 0.00
R4621:Ndufaf5 UTSW 2 140183925 missense probably benign 0.02
R4669:Ndufaf5 UTSW 2 140187755 missense probably benign 0.11
R5683:Ndufaf5 UTSW 2 140202923 missense possibly damaging 0.89
R6904:Ndufaf5 UTSW 2 140188780 nonsense probably null
R6937:Ndufaf5 UTSW 2 140181602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTATGCCAGGTTTTCCCATGTGA -3'
(R):5'- TGTGCTCTGACCTCCATGTACACCA -3'

Sequencing Primer
(F):5'- gtctttttgtctgttttctgcttg -3'
(R):5'- catgtacaccagcacacaag -3'
Posted On2014-05-09