Incidental Mutation 'R1654:Megf8'
ID188929
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25338486 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 809 (L809P)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000128119
AA Change: L809P

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: L809P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense not run
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGCAGCTTCCCAAAGTCTAGGAAC -3'
(R):5'- GAGGTCCAAGGCTGAAGTCAGAATC -3'

Sequencing Primer
(F):5'- TTCCCAAAGTCTAGGAACCCTTG -3'
(R):5'- GGCTGAAGTCAGAATCAAGTG -3'
Posted On2014-05-09