Incidental Mutation 'R1654:Sct'
ID188936
Institutional Source Beutler Lab
Gene Symbol Sct
Ensembl Gene ENSMUSG00000038580
Gene Namesecretin
Synonyms
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141278330-141279133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141278854 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 55 (Q55L)
Ref Sequence ENSEMBL: ENSMUSP00000041519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046156] [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000167790] [ENSMUST00000211667]
Predicted Effect probably damaging
Transcript: ENSMUST00000046156
AA Change: Q55L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041519
Gene: ENSMUSG00000038580
AA Change: Q55L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080654
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167263
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167790
AA Change: Q55L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128729
Gene: ENSMUSG00000038580
AA Change: Q55L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210928
Predicted Effect possibly damaging
Transcript: ENSMUST00000211667
AA Change: Q55L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the precursor of a gastrointestinal peptide hormone of the secretin-glucagon family. The encoded protein is secreted as a prohormone that undergoes proteolytic processing to generate a mature peptide hormone. The mature peptide regulates secretion of gastric acid, biocarbonate ions from pancreatic and biliary duct epithelia and water homeostasis in the gastrointestinal system. Mice lacking the encoded protein display decreased survival of neuroprogenitor cells during early postnatal period and impaired long-term potentiation and spatial learning in adulthood. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may be processed in a similar manner to generate the mature peptide hormone. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display impaired hippocampal synaptic function. Mice homozygous for a different knock-out allele fail exhibit increased water concsumption of vasopressin serum levels in response to ANGII treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Sct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:Sct APN 7 141278617 critical splice donor site probably null
R1879:Sct UTSW 7 141278699 missense probably damaging 0.98
R1898:Sct UTSW 7 141278848 missense probably damaging 1.00
R4762:Sct UTSW 7 141279041 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCGACCACAGCAAGCAGAG -3'
(R):5'- AGCATTTGTCACACCCAGAGCC -3'

Sequencing Primer
(F):5'- CAAGCAGAGCTGGTCCTCTAAG -3'
(R):5'- gctactgctgttgctgctg -3'
Posted On2014-05-09