Incidental Mutation 'R1654:Ptprk'
ID188948
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28383647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 361 (R361H)
Ref Sequence ENSEMBL: ENSMUSP00000126279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: R361H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: R361H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: R361H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: R361H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGATCCAACTAAATGCCAACTCT -3'
(R):5'- AGTTTCAAAACGCTCTCATACTGCTCT -3'

Sequencing Primer
(F):5'- CAACTCTATTATTGGCGATGGC -3'
(R):5'- atatGCCTAAATCATACACCAAATGG -3'
Posted On2014-05-09