Incidental Mutation 'R1654:Cacna1i'
ID188972
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Namecalcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80287238-80398279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80389210 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 1699 (A1699D)
Ref Sequence ENSEMBL: ENSMUSP00000125229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
Predicted Effect probably benign
Transcript: ENSMUST00000160175
SMART Domains Protein: ENSMUSP00000123881
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160424
AA Change: A1699D

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: A1699D

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161863
SMART Domains Protein: ENSMUSP00000124367
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162025
SMART Domains Protein: ENSMUSP00000125530
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 87 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: A1699D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: A1699D

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162913
SMART Domains Protein: ENSMUSP00000125617
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80382019 missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80355645 missense probably benign
IGL01338:Cacna1i APN 15 80348380 missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80387759 splice site probably benign
IGL01669:Cacna1i APN 15 80391757 missense probably benign
IGL01807:Cacna1i APN 15 80374147 missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80391732 missense probably benign 0.09
IGL01973:Cacna1i APN 15 80382033 missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80372951 missense probably benign 0.06
IGL02519:Cacna1i APN 15 80361874 nonsense probably null
IGL02648:Cacna1i APN 15 80298638 missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80362239 missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80355716 missense probably benign 0.30
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80356211 missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80372462 missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80368830 splice site probably benign
R0637:Cacna1i UTSW 15 80372654 missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80381080 missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80358949 missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80379054 missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80391774 splice site probably null
R1563:Cacna1i UTSW 15 80321188 missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80389855 splice site probably benign
R1573:Cacna1i UTSW 15 80393668 splice site probably null
R1754:Cacna1i UTSW 15 80371529 missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80389122 missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80376789 missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80358931 missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80391642 missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80375264 missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80395044 missense probably benign
R2162:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80374767 missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80381071 splice site probably benign
R3702:Cacna1i UTSW 15 80381071 splice site probably benign
R3832:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80388479 missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80369662 missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80368671 missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80348449 missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80390840 missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80371529 missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80371499 missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80395078 missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80389132 missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80321226 missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80336682 missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80355758 missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80378247 missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80321259 missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80374809 missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80374801 missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80380470 missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80361962 missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80362139 missense probably benign 0.03
X0058:Cacna1i UTSW 15 80379102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTAGGACACTCTGCGAGACTG -3'
(R):5'- GATCGCCCTCTCTTGAAGCTGAAC -3'

Sequencing Primer
(F):5'- TCTGCGAGACTGCACCC -3'
(R):5'- ACAGGTGGCTCTCAGTGTC -3'
Posted On2014-05-09