Incidental Mutation 'R1654:Krt80'
ID188973
Institutional Source Beutler Lab
Gene Symbol Krt80
Ensembl Gene ENSMUSG00000037185
Gene Namekeratin 80
Synonyms1200016G03Rik, 2310041I20Rik, Kb20
MMRRC Submission 039690-MU
Accession Numbers

Genbank: NM_028770.2; Ensembl: ENSMUST00000077196

Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1654 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location101347444-101370162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101351709 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 255 (K255E)
Ref Sequence ENSEMBL: ENSMUSP00000155346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077196] [ENSMUST00000230831] [ENSMUST00000230909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077196
AA Change: K308E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076437
Gene: ENSMUSG00000037185
AA Change: K308E

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 79 2.5e-12 PFAM
Filament 82 393 2.18e-113 SMART
low complexity region 419 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230070
Predicted Effect probably damaging
Transcript: ENSMUST00000230831
AA Change: K93E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000230909
AA Change: K255E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene's expression profile shows that it encodes a type II epithelial keratin, although structurally the encoded protein is more like a type II hair keratin. This protein is involved in cell differentiation, localizing near desmosomal plaques in earlier stages of differentiation but then dispersing throughout the cytoplasm in terminally differentiating cells. The type II keratins are clustered in a region of chromosome 12q13. Two transcript variants encoding two different fully functional isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Krt80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Krt80 APN 15 101349998 missense possibly damaging 0.64
IGL03184:Krt80 APN 15 101352254 missense probably damaging 1.00
1mM(1):Krt80 UTSW 15 101364208 critical splice donor site probably null
R0394:Krt80 UTSW 15 101352299 missense probably damaging 0.97
R0520:Krt80 UTSW 15 101370017 missense probably benign 0.00
R2436:Krt80 UTSW 15 101359503 missense probably damaging 0.98
R4326:Krt80 UTSW 15 101352308 missense possibly damaging 0.52
R5292:Krt80 UTSW 15 101352185 missense probably damaging 1.00
R5783:Krt80 UTSW 15 101359479 critical splice donor site probably null
R5927:Krt80 UTSW 15 101364208 critical splice donor site probably benign
R6847:Krt80 UTSW 15 101358729 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCAGCACCTGAGACGTAGGTC -3'
(R):5'- CCCTGAGATTCTCTGAGGCGTATCG -3'

Sequencing Primer
(F):5'- AGCTCTGGGCACTTTACAG -3'
(R):5'- TTGCAGCATCCAGTCCACAG -3'
Posted On2014-05-09