Incidental Mutation 'R1656:Syt1'
ID189125
Institutional Source Beutler Lab
Gene Symbol Syt1
Ensembl Gene ENSMUSG00000035864
Gene Namesynaptotagmin I
Synonyms
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location108497650-109010982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108583915 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 295 (E295G)
Ref Sequence ENSEMBL: ENSMUSP00000100912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064054] [ENSMUST00000105276]
Predicted Effect probably damaging
Transcript: ENSMUST00000064054
AA Change: E295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063293
Gene: ENSMUSG00000035864
AA Change: E295G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.8e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105276
AA Change: E295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100912
Gene: ENSMUSG00000035864
AA Change: E295G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.9e-26 SMART
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous null mice do not suckle, show impaired synaptic transmission and Ca2+-evoked neurotransmitter release, and die by 48 hrs of life. Knock-in mice bearing a missense mutation show enhanced synaptic depression while those carrying a point mutationshow reduced synaptic release probability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc26a7 A T 4: 14,621,221 I55K possibly damaging Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Syt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Syt1 APN 10 108583975 missense possibly damaging 0.49
R1067:Syt1 UTSW 10 108636662 missense probably benign
R1300:Syt1 UTSW 10 108631821 missense possibly damaging 0.95
R1370:Syt1 UTSW 10 108690922 missense probably damaging 0.98
R1575:Syt1 UTSW 10 108504500 missense probably benign 0.04
R2072:Syt1 UTSW 10 108583972 missense probably damaging 1.00
R2212:Syt1 UTSW 10 108504414 missense possibly damaging 0.89
R2429:Syt1 UTSW 10 108690920 missense possibly damaging 0.86
R4928:Syt1 UTSW 10 108504512 missense possibly damaging 0.95
R5216:Syt1 UTSW 10 108642257 missense probably benign 0.00
R6161:Syt1 UTSW 10 108631807 missense probably damaging 1.00
R6193:Syt1 UTSW 10 108500736 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GAAGACTTCCTCACTGCCATGTCC -3'
(R):5'- GACGCTAGTTGTCATCACCATCCTC -3'

Sequencing Primer
(F):5'- tcttctttgccaatttcaataaactg -3'
(R):5'- TCACCATCCTCTTGAGGAAATTAC -3'
Posted On2014-05-09