Incidental Mutation 'R0026:Kctd3'
ID189160
Institutional Source Beutler Lab
Gene Symbol Kctd3
Ensembl Gene ENSMUSG00000026608
Gene Namepotassium channel tetramerisation domain containing 3
SynonymsE330032J19Rik, NY-REN-45, 4930438A20Rik
MMRRC Submission 038321-MU
Accession Numbers

Genbank: NM_172650; MGI: 2444629

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R0026 (G1)
Quality Score55
Status Validated
Chromosome1
Chromosomal Location188971095-189007841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 188976621 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 519 (T519A)
Ref Sequence ENSEMBL: ENSMUSP00000082821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085678] [ENSMUST00000192458] [ENSMUST00000193143]
Predicted Effect probably damaging
Transcript: ENSMUST00000085678
AA Change: T519A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082821
Gene: ENSMUSG00000026608
AA Change: T519A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BTB 18 118 1.74e-15 SMART
Blast:WD40 184 263 5e-50 BLAST
WD40 269 305 1.32e2 SMART
WD40 411 449 7.43e-1 SMART
WD40 519 569 2.66e0 SMART
low complexity region 619 637 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192200
Predicted Effect probably damaging
Transcript: ENSMUST00000192458
AA Change: T11A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000193143
AA Change: T519A

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141861
Gene: ENSMUSG00000026608
AA Change: T519A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BTB 18 118 1.1e-17 SMART
Blast:WD40 184 263 3e-49 BLAST
WD40 269 305 8.1e-1 SMART
WD40 411 449 4.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195488
Predicted Effect unknown
Transcript: ENSMUST00000195658
AA Change: T63A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195787
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Kctd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Kctd3 APN 1 188972196 missense probably damaging 1.00
IGL00766:Kctd3 APN 1 188995776 missense probably benign 0.29
IGL01393:Kctd3 APN 1 189000290 missense probably benign 0.03
IGL01874:Kctd3 APN 1 188996991 missense probably damaging 1.00
IGL01966:Kctd3 APN 1 188992662 missense probably damaging 1.00
3-1:Kctd3 UTSW 1 188972257 nonsense probably null
R0142:Kctd3 UTSW 1 188996398 critical splice donor site probably null
R0619:Kctd3 UTSW 1 188978643 missense probably damaging 1.00
R0621:Kctd3 UTSW 1 188981341 missense probably damaging 1.00
R0733:Kctd3 UTSW 1 188997050 splice site probably benign
R0843:Kctd3 UTSW 1 188996973 nonsense probably null
R2393:Kctd3 UTSW 1 188981371 missense probably damaging 1.00
R4004:Kctd3 UTSW 1 188992743 missense probably benign 0.06
R4005:Kctd3 UTSW 1 189001927 missense possibly damaging 0.96
R4091:Kctd3 UTSW 1 188995720 intron probably benign
R4784:Kctd3 UTSW 1 188974468 missense probably damaging 1.00
R5062:Kctd3 UTSW 1 188995693 intron probably benign
R5488:Kctd3 UTSW 1 188981366 missense probably damaging 1.00
R6013:Kctd3 UTSW 1 188996468 missense probably benign 0.00
R6310:Kctd3 UTSW 1 188972238 missense probably benign 0.00
R6478:Kctd3 UTSW 1 188972364 missense probably benign
R6703:Kctd3 UTSW 1 188996529 missense probably damaging 1.00
X0019:Kctd3 UTSW 1 188972589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACCTAATGGAGACACGCTTG -3'
(R):5'- TGCTGGGAAGAGGAGTGTCAGTATC -3'

Sequencing Primer
(F):5'- GTCCCATCCAGGGTCATTATG -3'
(R):5'- AGAGGAGTGTCAGTATCAGTGTG -3'
Posted On2014-05-13