Incidental Mutation 'R0026:Szt2'
ID189165
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R0026 (G1)
Quality Score56
Status Validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118384772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1612 (S1612R)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075406
AA Change: S1612R

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S1612R

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136737
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
X0023:Szt2 UTSW 4 118372404 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTCTCGGATGTTGACCTAGAC -3'
(R):5'- TCAGATGCAGACACTGTGAACCCC -3'

Sequencing Primer
(F):5'- TTGACCTAGACAGGGTAGGAGC -3'
(R):5'- CGATGAGGACTCCTTCAGTATCTTAG -3'
Posted On2014-05-13