Incidental Mutation 'R0026:Otud7a'
ID189172
Institutional Source Beutler Lab
Gene Symbol Otud7a
Ensembl Gene ENSMUSG00000033510
Gene NameOTU domain containing 7A
SynonymsCezanne 2 protein, Otud7
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0026 (G1)
Quality Score73
Status Validated
Chromosome7
Chromosomal Location63444751-63759028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63735801 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 338 (F338L)
Ref Sequence ENSEMBL: ENSMUSP00000057282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058476] [ENSMUST00000177534]
Predicted Effect probably benign
Transcript: ENSMUST00000058476
AA Change: F338L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057282
Gene: ENSMUSG00000033510
AA Change: F338L

DomainStartEndE-ValueType
PDB:2L2D|A 11 82 4e-43 PDB
Pfam:OTU 207 371 1.5e-26 PFAM
low complexity region 478 510 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 559 581 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 730 777 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 865 872 N/A INTRINSIC
Pfam:zf-A20 888 912 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177534
AA Change: F344L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135559
Gene: ENSMUSG00000033510
AA Change: F344L

DomainStartEndE-ValueType
Pfam:UBA_4 28 66 2e-7 PFAM
Pfam:OTU 206 377 5.7e-32 PFAM
low complexity region 484 516 N/A INTRINSIC
low complexity region 533 553 N/A INTRINSIC
low complexity region 565 587 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinizing enzyme and possible tumor suppressor. The encoded protein acts on TNF receptor associated factor 6 (TRAF6) to control nuclear factor kappa B expression. However, this gene is downregulated by SNAIL1 in hepatocellular carcinoma cells, contributing to their progression and malignancy. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal spike wave discharge, decreased dendritic spine density, decreased prepulse inhibition, impaired coordination, decreased grip strength, decreased startle reflex, impaired ultrasonic vocalization and delayed tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Otud7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Otud7a UTSW 7 63697244 splice site probably benign
R0576:Otud7a UTSW 7 63685518 missense possibly damaging 0.93
R0594:Otud7a UTSW 7 63727472 nonsense probably null
R0611:Otud7a UTSW 7 63735890 missense possibly damaging 0.84
R1473:Otud7a UTSW 7 63754629 splice site probably benign
R1519:Otud7a UTSW 7 63758643 missense probably damaging 1.00
R1694:Otud7a UTSW 7 63733710 missense probably damaging 1.00
R1941:Otud7a UTSW 7 63729826 nonsense probably null
R1952:Otud7a UTSW 7 63650876 missense probably damaging 0.96
R2199:Otud7a UTSW 7 63757656 missense possibly damaging 0.53
R2404:Otud7a UTSW 7 63697151 missense probably benign 0.20
R4238:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4239:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4294:Otud7a UTSW 7 63697191 missense probably damaging 0.99
R4512:Otud7a UTSW 7 63729877 missense probably benign 0.32
R4748:Otud7a UTSW 7 63735915 missense possibly damaging 0.73
R4815:Otud7a UTSW 7 63729910 critical splice donor site probably null
R4942:Otud7a UTSW 7 63757423 missense probably damaging 0.99
R5249:Otud7a UTSW 7 63757433 missense possibly damaging 0.53
R5332:Otud7a UTSW 7 63735826 missense probably damaging 0.98
R5438:Otud7a UTSW 7 63757459 missense unknown
R6185:Otud7a UTSW 7 63758385 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGACAGCATGGACTCCTAGCC -3'
(R):5'- ACATCTGCATTTCGACTGAGCATGG -3'

Sequencing Primer
(F):5'- GTGGGGGATATCACCAACCATC -3'
(R):5'- TTCGACTGAGCATGGCTACG -3'
Posted On2014-05-13