Incidental Mutation 'R0026:Abca16'
ID189173
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission 038321-MU
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0026 (G1)
Quality Score77
Status Validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 120477923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably benign
Transcript: ENSMUST00000056042
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153845
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6883:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCATTCTGTGCCTTAGCTCAAGTG -3'
(R):5'- GGACAAAATGGGTCAGCAACTTTGTG -3'

Sequencing Primer
(F):5'- GATACTTGATGAGCCATCATCCG -3'
(R):5'- TGTGTAAAATTGCAAAAAACCGTG -3'
Posted On2014-05-13