Incidental Mutation 'R0026:Slc5a2'
ID189174
Institutional Source Beutler Lab
Gene Symbol Slc5a2
Ensembl Gene ENSMUSG00000030781
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 2
SynonymsSglt2
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0026 (G1)
Quality Score64
Status Validated
Chromosome7
Chromosomal Location128265657-128272430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128270053 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 335 (I335N)
Ref Sequence ENSEMBL: ENSMUSP00000145581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000033045] [ENSMUST00000118169] [ENSMUST00000126263] [ENSMUST00000137038] [ENSMUST00000142841] [ENSMUST00000153418] [ENSMUST00000205720] [ENSMUST00000206909]
Predicted Effect probably benign
Transcript: ENSMUST00000033044
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000033045
AA Change: I294N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000118169
AA Change: I335N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781
AA Change: I335N

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126263
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136345
Predicted Effect probably benign
Transcript: ENSMUST00000137038
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142841
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147091
Predicted Effect probably benign
Transcript: ENSMUST00000153418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171335
Predicted Effect probably damaging
Transcript: ENSMUST00000205720
AA Change: I335N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000206703
Predicted Effect unknown
Transcript: ENSMUST00000206716
AA Change: I118N
Predicted Effect probably benign
Transcript: ENSMUST00000206909
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Slc5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
dregs UTSW 7 128267505 splice site probably null
jimbee UTSW 7 large deletion
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0544:Slc5a2 UTSW 7 128269999 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6185:Slc5a2 UTSW 7 128271177 missense probably damaging 0.98
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCTTATCCCATGTGAGTTACAGG -3'
(R):5'- TAGTGTGAACGGCGAATCAGGTCC -3'

Sequencing Primer
(F):5'- ATCTGGATGCCCCTTATCCCAT -3'
(R):5'- TCTGGATGTGGGTCACAGTA -3'
Posted On2014-05-13