Incidental Mutation 'R0026:Mlycd'
ID189177
Institutional Source Beutler Lab
Gene Symbol Mlycd
Ensembl Gene ENSMUSG00000074064
Gene Namemalonyl-CoA decarboxylase
SynonymsMcd
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0026 (G1)
Quality Score38
Status Validated
Chromosome8
Chromosomal Location119394878-119411102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119410435 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 465 (I465V)
Ref Sequence ENSEMBL: ENSMUSP00000095970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098367]
Predicted Effect probably benign
Transcript: ENSMUST00000098367
AA Change: I465V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095970
Gene: ENSMUSG00000074064
AA Change: I465V

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
Pfam:MCD 92 456 1.3e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145121
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene catalyzes the breakdown of malonyl-CoA to acetyl-CoA and carbon dioxide. Malonyl-CoA is an intermediate in fatty acid biosynthesis, and also inhibits the transport of fatty acyl CoAs into mitochondria. Consequently, the encoded protein acts to increase the rate of fatty acid oxidation. It is found in mitochondria, peroxisomes, and the cytoplasm. Mutations in this gene result in malonyl-CoA decarboyxlase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered cardiac metabolism following ischemia and improved recovery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Mlycd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Mlycd APN 8 119410334 missense probably damaging 1.00
IGL02976:Mlycd APN 8 119401485 missense possibly damaging 0.70
PIT4142001:Mlycd UTSW 8 119410460 missense probably damaging 1.00
R0164:Mlycd UTSW 8 119407641 missense probably damaging 1.00
R0164:Mlycd UTSW 8 119407641 missense probably damaging 1.00
R1531:Mlycd UTSW 8 119401519 nonsense probably null
R2508:Mlycd UTSW 8 119407707 critical splice donor site probably null
R4449:Mlycd UTSW 8 119410405 missense probably damaging 1.00
R5061:Mlycd UTSW 8 119410304 missense probably damaging 1.00
R5781:Mlycd UTSW 8 119410280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTGTTCACGAGAGCCTCAAG -3'
(R):5'- TGTGGTAAGTAAGCCTGGCCCATC -3'

Sequencing Primer
(F):5'- GGCCACTAATGAGGCTGTG -3'
(R):5'- TCAGAACACAGCCTCCTTTCTAAG -3'
Posted On2014-05-13