Incidental Mutation 'R0026:Dbn1'
ID189187
Institutional Source Beutler Lab
Gene Symbol Dbn1
Ensembl Gene ENSMUSG00000034675
Gene Namedrebrin 1
Synonymsdrebrin A, drebrin E2
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0026 (G1)
Quality Score78
Status Validated
Chromosome13
Chromosomal Location55473429-55488111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55477784 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 275 (E275G)
Ref Sequence ENSEMBL: ENSMUSP00000105547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021950] [ENSMUST00000046533] [ENSMUST00000109921] [ENSMUST00000109923] [ENSMUST00000139275]
Predicted Effect probably damaging
Transcript: ENSMUST00000021950
AA Change: E275G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021950
Gene: ENSMUSG00000034675
AA Change: E275G

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 453 473 N/A INTRINSIC
low complexity region 477 498 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
low complexity region 697 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046533
SMART Domains Protein: ENSMUSP00000046776
Gene: ENSMUSG00000034686

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
low complexity region 63 131 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109921
AA Change: E275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105547
Gene: ENSMUSG00000034675
AA Change: E275G

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 652 660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109923
AA Change: E275G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105549
Gene: ENSMUSG00000034675
AA Change: E275G

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 651 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135705
Predicted Effect probably benign
Transcript: ENSMUST00000139275
SMART Domains Protein: ENSMUSP00000122574
Gene: ENSMUSG00000034675

DomainStartEndE-ValueType
Pfam:Cofilin_ADF 1 71 9.1e-14 PFAM
coiled coil region 113 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183653
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired cued conditioning behavior. Mice homozygous for a different knock-out allele show altered neurotransmitter receptor levels in protein complexes, abnormal dendritic spine morphology, and impaired synaptic plasticity in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Dbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Dbn1 APN 13 55482189 missense probably damaging 1.00
IGL01408:Dbn1 APN 13 55482304 splice site probably benign
IGL02123:Dbn1 APN 13 55476740 missense possibly damaging 0.82
R0318:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0319:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0400:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0417:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0765:Dbn1 UTSW 13 55482294 missense probably damaging 1.00
R0905:Dbn1 UTSW 13 55474227 unclassified probably benign
R1695:Dbn1 UTSW 13 55476708 missense probably benign 0.01
R1844:Dbn1 UTSW 13 55481347 critical splice donor site probably null
R1997:Dbn1 UTSW 13 55482441 missense probably damaging 1.00
R2912:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R2914:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R4398:Dbn1 UTSW 13 55475381 missense probably benign 0.05
R4477:Dbn1 UTSW 13 55481561 small deletion probably benign
R4515:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4518:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4519:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4678:Dbn1 UTSW 13 55475258 missense probably benign
R4886:Dbn1 UTSW 13 55477542 unclassified probably benign
R6272:Dbn1 UTSW 13 55475104 missense probably benign 0.00
R6741:Dbn1 UTSW 13 55481537 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTCCTGCTGTCTGAAGAACTCCC -3'
(R):5'- GCCATATTCAGTCCGTGCTTGGTG -3'

Sequencing Primer
(F):5'- CGTGGGTTATCAGGCCG -3'
(R):5'- GATCCCAGATACCTGGTTAGATG -3'
Posted On2014-05-13