Incidental Mutation 'R0026:Cma1'
ID189188
Institutional Source Beutler Lab
Gene Symbol Cma1
Ensembl Gene ENSMUSG00000022225
Gene Namechymase 1, mast cell
SynonymsMcp-5, MMCP-5, Mcpt5, Mcp5
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R0026 (G1)
Quality Score34
Status Validated
Chromosome14
Chromosomal Location55941451-55944675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55942164 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 188 (C188S)
Ref Sequence ENSEMBL: ENSMUSP00000154406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000226280]
Predicted Effect probably damaging
Transcript: ENSMUST00000022834
AA Change: C201S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225
AA Change: C201S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226280
AA Change: C188S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227704
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Cma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Cma1 APN 14 55942697 missense probably benign 0.26
IGL02797:Cma1 APN 14 55943814 missense possibly damaging 0.58
R2029:Cma1 UTSW 14 55943734 missense possibly damaging 0.81
R2060:Cma1 UTSW 14 55943698 critical splice donor site probably null
R4994:Cma1 UTSW 14 55941671 missense probably damaging 1.00
R5275:Cma1 UTSW 14 55941700 missense probably damaging 1.00
R5794:Cma1 UTSW 14 55944520 missense probably benign
R5824:Cma1 UTSW 14 55941725 missense possibly damaging 0.79
R5955:Cma1 UTSW 14 55943769 missense probably benign 0.20
R5958:Cma1 UTSW 14 55941656 makesense probably null
R6075:Cma1 UTSW 14 55942314 missense probably damaging 0.97
R6139:Cma1 UTSW 14 55942700 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGAACAGCAGAAGAGGTGACCC -3'
(R):5'- TTGAAGGAGAAAGCCAAGCTAACCC -3'

Sequencing Primer
(F):5'- AGGTGACCCAGGATAGCC -3'
(R):5'- TAGGTGTGGGAACCCTCC -3'
Posted On2014-05-13