Incidental Mutation 'R0026:Ephb3'
ID189191
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R0026 (G1)
Quality Score35
Status Validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21214917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 251 (D251G)
Ref Sequence ENSEMBL: ENSMUSP00000006112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063] [ENSMUST00000231316] [ENSMUST00000232407]
Predicted Effect probably damaging
Transcript: ENSMUST00000006112
AA Change: D251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: D251G

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect probably benign
Transcript: ENSMUST00000161063
Predicted Effect probably benign
Transcript: ENSMUST00000231316
Predicted Effect probably benign
Transcript: ENSMUST00000232407
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Rrm2b T C 15: 37,953,741 E21G probably benign Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21220775 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1126:Ephb3 UTSW 16 21222476 missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21218243 missense probably benign
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21220495 missense probably benign 0.09
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21221468 missense probably benign
R6590:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGAAGTGTGCATCCACCACTG -3'
(R):5'- AGGTTCGCACTGCTCACTAATCAAG -3'

Sequencing Primer
(F):5'- GCAGGCTTCGCACTCTTC -3'
(R):5'- cccaccactgagtatgtcc -3'
Posted On2014-05-13