Incidental Mutation 'R1682:Prom2'
ID189214
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission 039718-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1682 (G1)
Quality Score157
Status Not validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127540162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 111 (V111L)
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028855
AA Change: V111L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: V111L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103214
AA Change: V111L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: V111L

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155581
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 D2203G probably benign Het
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dnah12 A T 14: 26,778,883 T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eln C A 5: 134,703,782 *861L probably null Het
Eml6 T A 11: 29,759,065 H24L probably benign Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Slc17a2 A T 13: 23,812,640 I43F probably damaging Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0165:Prom2 UTSW 2 127539514 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127539995 critical splice donor site probably null
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R0947:Prom2 UTSW 2 127538263 missense possibly damaging 0.69
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6215:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6914:Prom2 UTSW 2 127530375 missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127539778 missense probably benign
R7427:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7428:Prom2 UTSW 2 127539811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTTCAGGGACATCAGAGACCAG -3'
(R):5'- TGCAATGGTAAGGGTGCCATCAC -3'

Sequencing Primer
(F):5'- TCAGGGACAGCTTTCACACTG -3'
(R):5'- AAGGGTGCCATCACCTTGTG -3'
Posted On2014-05-14