Incidental Mutation 'R1682:Eln'
ID189231
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
MMRRC Submission 039718-MU
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1682 (G1)
Quality Score185
Status Not validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) C to A at 134703782 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 861 (*861L)
Ref Sequence ENSEMBL: ENSMUSP00000015138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect probably null
Transcript: ENSMUST00000015138
AA Change: *861L
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675
AA Change: *861L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202570
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 D2203G probably benign Het
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dnah12 A T 14: 26,778,883 T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eml6 T A 11: 29,759,065 H24L probably benign Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Prom2 C A 2: 127,540,162 V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Slc17a2 A T 13: 23,812,640 I43F probably damaging Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1481:Eln UTSW 5 134706572 missense probably damaging 0.99
R1741:Eln UTSW 5 134729184 missense unknown
R1926:Eln UTSW 5 134706567 nonsense probably null
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCACCAATTTCCCTTGGAGATGG -3'
(R):5'- TCTTCTCAGAATTCAGCAGGCTGTG -3'

Sequencing Primer
(F):5'- AATTTCCCTTGGAGATGGAGACTG -3'
(R):5'- ggaaggaagggagggagg -3'
Posted On2014-05-14