Incidental Mutation 'R1682:Eml6'
ID189259
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 039718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R1682 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29759065 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 24 (H24L)
Ref Sequence ENSEMBL: ENSMUSP00000116197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000137689]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: H1452L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: H1452L

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123881
Predicted Effect probably benign
Transcript: ENSMUST00000137689
AA Change: H24L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116197
Gene: ENSMUSG00000044072
AA Change: H24L

DomainStartEndE-ValueType
SCOP:d2bbkh_ 14 72 9e-8 SMART
Blast:WD40 22 64 1e-24 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 D2203G probably benign Het
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dnah12 A T 14: 26,778,883 T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eln C A 5: 134,703,782 *861L probably null Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Prom2 C A 2: 127,540,162 V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Slc17a2 A T 13: 23,812,640 I43F probably damaging Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTAGCTCACCAAGGCTTGTGCTC -3'
(R):5'- GCAGCAAATTCCTCAGTGTCTTTCG -3'

Sequencing Primer
(F):5'- TTGCAGCAGGACCCATGAG -3'
(R):5'- ACTGAGGTACCACCATCTCT -3'
Posted On2014-05-14