Incidental Mutation 'R1682:Slc17a2'
ID189274
Institutional Source Beutler Lab
Gene Symbol Slc17a2
Ensembl Gene ENSMUSG00000036110
Gene Namesolute carrier family 17 (sodium phosphate), member 2
SynonymsNPT3
MMRRC Submission 039718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1682 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23806993-23825180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23812640 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 43 (I43F)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
Predicted Effect probably damaging
Transcript: ENSMUST00000006786
AA Change: I43F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: I43F

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099697
AA Change: I43F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: I43F

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141717
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 D2203G probably benign Het
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dnah12 A T 14: 26,778,883 T1543S possibly damaging Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eln C A 5: 134,703,782 *861L probably null Het
Eml6 T A 11: 29,759,065 H24L probably benign Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Prom2 C A 2: 127,540,162 V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Slc17a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc17a2 APN 13 23819334 missense probably benign 0.13
IGL01511:Slc17a2 APN 13 23819138 critical splice donor site probably null
IGL01624:Slc17a2 APN 13 23814986 missense probably benign 0.00
IGL01839:Slc17a2 APN 13 23812685 missense possibly damaging 0.91
IGL02010:Slc17a2 APN 13 23819042 missense probably benign 0.00
IGL03299:Slc17a2 APN 13 23821111 critical splice donor site probably null
R0622:Slc17a2 UTSW 13 23812611 missense probably damaging 1.00
R1104:Slc17a2 UTSW 13 23819937 missense probably damaging 0.99
R1530:Slc17a2 UTSW 13 23819069 missense probably damaging 1.00
R2255:Slc17a2 UTSW 13 23821008 missense probably benign 0.09
R4923:Slc17a2 UTSW 13 23819095 missense probably benign 0.20
R5193:Slc17a2 UTSW 13 23819862 critical splice acceptor site probably null
R5321:Slc17a2 UTSW 13 23812631 missense possibly damaging 0.95
R5334:Slc17a2 UTSW 13 23819051 missense probably damaging 0.97
R5377:Slc17a2 UTSW 13 23812592 missense probably damaging 1.00
R6165:Slc17a2 UTSW 13 23815070 missense probably benign 0.00
R6280:Slc17a2 UTSW 13 23822394 missense probably benign
R6311:Slc17a2 UTSW 13 23815022 missense probably benign 0.40
R6323:Slc17a2 UTSW 13 23814986 missense probably benign 0.00
R6476:Slc17a2 UTSW 13 23812586 missense probably damaging 1.00
R6814:Slc17a2 UTSW 13 23822389 missense possibly damaging 0.55
R7155:Slc17a2 UTSW 13 23822407 missense probably benign 0.21
R7188:Slc17a2 UTSW 13 23822365 missense probably damaging 1.00
R7288:Slc17a2 UTSW 13 23819112 missense probably benign 0.09
R7462:Slc17a2 UTSW 13 23822418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCAGTTTCCTTTCAGGTGTTC -3'
(R):5'- AACCCAGAAGGGTTCCCTAGACAG -3'

Sequencing Primer
(F):5'- AGGTGTTCATTCTGTAACCCTG -3'
(R):5'- TTATGACAGACTCAAGCAATGGC -3'
Posted On2014-05-14