Incidental Mutation 'R1682:Dnah12'
ID189278
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 039718-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1682 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26778883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1543 (T1543S)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022433
AA Change: T1543S

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: T1543S

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,392,217 D2203G probably benign Het
Acin1 A G 14: 54,663,718 S629P probably damaging Het
Agbl2 T A 2: 90,784,090 I22N probably benign Het
Ank1 A G 8: 23,109,327 E796G probably damaging Het
Ankrd13d A G 19: 4,282,933 L13P probably damaging Het
Ankrd36 T C 11: 5,607,143 S364P possibly damaging Het
Ap2a1 T C 7: 44,915,938 T126A probably benign Het
Apob A G 12: 8,012,365 I3616V probably benign Het
Arl5a A T 2: 52,416,202 N39K probably benign Het
Baiap2 G A 11: 119,997,540 R334H probably damaging Het
Bbox1 T A 2: 110,292,548 N132I possibly damaging Het
Bcl11b A G 12: 107,916,649 L469P probably damaging Het
Brca1 A G 11: 101,525,565 I581T probably damaging Het
Cacng2 T C 15: 78,118,797 Y32C probably damaging Het
Capn9 G T 8: 124,611,565 probably null Het
Cdh18 A G 15: 23,400,585 T290A probably benign Het
Cdk5rap2 C T 4: 70,302,150 V593I possibly damaging Het
Cep128 G C 12: 91,230,822 D91E probably damaging Het
Cep295 T C 9: 15,333,921 M1080V probably benign Het
Coq8b T A 7: 27,240,124 M193K probably benign Het
Csn1s2b A G 5: 87,822,303 Y131C probably damaging Het
D130043K22Rik T C 13: 24,882,556 S779P probably damaging Het
Dgat1 C T 15: 76,503,019 C356Y probably benign Het
Dock3 T C 9: 106,973,841 S821G probably damaging Het
Dock4 G A 12: 40,725,780 C574Y probably damaging Het
Dr1 T C 5: 108,269,738 I50T probably damaging Het
Dzip3 A T 16: 48,958,417 probably null Het
Eln C A 5: 134,703,782 *861L probably null Het
Eml6 T A 11: 29,759,065 H24L probably benign Het
Eps8l3 A C 3: 107,891,306 T503P possibly damaging Het
Fam69c A T 18: 84,736,863 I155F possibly damaging Het
Fgf1 C A 18: 38,841,932 D155Y possibly damaging Het
Fkbp15 A T 4: 62,324,194 M507K probably damaging Het
Flnb A T 14: 7,913,121 R1463S probably benign Het
Fras1 C T 5: 96,645,873 T1018I probably benign Het
Gm10803 T A 2: 93,564,188 C102S probably damaging Het
Gpatch1 C A 7: 35,303,387 V233L possibly damaging Het
Gramd1a T C 7: 31,142,900 probably null Het
Gsk3a T C 7: 25,235,708 T106A possibly damaging Het
Hap1 A G 11: 100,349,476 V136A possibly damaging Het
Helq A T 5: 100,792,813 S307T probably benign Het
Herc2 T A 7: 56,088,400 S264T possibly damaging Het
Htr4 A G 18: 62,428,066 M133V possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jakmip2 A G 18: 43,581,831 probably null Het
Ldhd T A 8: 111,628,113 S358C possibly damaging Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Ltbp3 A G 19: 5,751,754 D700G probably benign Het
Magel2 T G 7: 62,380,235 S962R unknown Het
Map2 A C 1: 66,415,622 probably null Het
Map3k1 T A 13: 111,757,150 E704V probably damaging Het
Mrpl39 A T 16: 84,730,459 V180D probably damaging Het
Myef2 T C 2: 125,098,058 M383V probably damaging Het
Myh3 A G 11: 67,089,065 Y610C probably damaging Het
Olfr1328 A G 4: 118,934,581 L89P probably damaging Het
Olfr555 T C 7: 102,659,697 V292A probably damaging Het
Olfr969 T A 9: 39,795,658 Y94* probably null Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pabpc1 T A 15: 36,605,541 N135I possibly damaging Het
Pcsk6 T A 7: 65,910,228 H100Q probably damaging Het
Pdss1 A G 2: 22,915,519 K270E probably damaging Het
Pigx A T 16: 32,087,450 S18T possibly damaging Het
Plbd2 T A 5: 120,485,784 T558S probably damaging Het
Plppr1 A T 4: 49,325,617 probably null Het
Plppr2 T A 9: 21,944,421 V230E possibly damaging Het
Pola2 A G 19: 5,953,063 probably null Het
Ppp2r3a A G 9: 101,212,306 S273P probably benign Het
Prkdc A G 16: 15,676,989 E741G probably benign Het
Prom2 C A 2: 127,540,162 V111L possibly damaging Het
Rapgef4 A G 2: 72,226,568 D557G possibly damaging Het
Rgs10 T C 7: 128,373,970 T158A probably benign Het
Rnf123 A C 9: 108,077,398 Y40D probably benign Het
Rnf14 A G 18: 38,308,189 T211A probably benign Het
Rp1l1 T A 14: 64,028,968 S668T probably damaging Het
Sema6d T A 2: 124,665,149 L946Q probably benign Het
Sgcd T G 11: 47,195,042 K94Q probably benign Het
Skor2 A T 18: 76,859,516 D311V unknown Het
Slc17a2 A T 13: 23,812,640 I43F probably damaging Het
Spdye4c C A 2: 128,592,622 P40T probably damaging Het
Srp72 C A 5: 76,987,870 Q216K possibly damaging Het
Tmem62 C T 2: 121,007,057 T485I probably benign Het
Tmem94 G T 11: 115,790,230 V432L probably damaging Het
Trio T C 15: 27,744,146 probably null Het
Uggt2 A T 14: 119,054,643 D581E probably benign Het
Unc5d T A 8: 28,759,081 S319C probably damaging Het
Vmn1r211 T C 13: 22,851,643 I285V probably damaging Het
Vmn2r68 A G 7: 85,233,366 Y393H possibly damaging Het
Vmn2r99 A C 17: 19,377,945 N77T probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGGAAAGACTACCCACTTCTGAACT -3'
(R):5'- CGGGACATTTCTACCTTGATGCTCAAA -3'

Sequencing Primer
(F):5'- CAGGATGATTTGCATATACAGTGCC -3'
(R):5'- CCTTGATGCTCAAAGTAGGATTAGAG -3'
Posted On2014-05-14