Incidental Mutation 'R1686:Arhgap21'
ID189308
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20881848 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 12 (Y12N)
Ref Sequence ENSEMBL: ENSMUSP00000133347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably damaging
Transcript: ENSMUST00000114594
AA Change: Y177N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: Y177N

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141298
AA Change: Y183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: Y183N

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154230
AA Change: Y183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: Y183N

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156142
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: Y173N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: Y173N

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174584
AA Change: Y12N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: Y12N

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTTCGGTAATGAATCAGGAGGGC -3'
(R):5'- AGGGGAGATGTGATCTGTCTCATAAGC -3'

Sequencing Primer
(F):5'- CATGTTTCCACCGGCTGTG -3'
(R):5'- ggagggaagggagggaag -3'
Posted On2014-05-14