Incidental Mutation 'R1686:Prkcz'
ID189330
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155271256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 227 (T227A)
Ref Sequence ENSEMBL: ENSMUSP00000099467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030922
AA Change: T410A

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: T410A

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103178
AA Change: T227A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: T227A

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140256
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTCAGGGAGTATGCAACGGGTAAC -3'
(R):5'- ACGGACACATTAAGCTGACGGAC -3'

Sequencing Primer
(F):5'- AAACCCTGAGGGGTGTTCTG -3'
(R):5'- CATTAAGCTGACGGACTACGG -3'
Posted On2014-05-14