Incidental Mutation 'R1686:Adgrg3'
ID189350
Institutional Source Beutler Lab
Gene Symbol Adgrg3
Ensembl Gene ENSMUSG00000060470
Gene Nameadhesion G protein-coupled receptor G3
SynonymsGpr97, Pb99, A030001G24Rik
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95017692-95045250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95033369 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000051079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051259]
Predicted Effect probably benign
Transcript: ENSMUST00000051259
AA Change: N72S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470
AA Change: N72S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 209 256 3.45e-11 SMART
Pfam:7tm_2 260 509 5.1e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211994
Predicted Effect probably benign
Transcript: ENSMUST00000212570
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a A C 1: 24,029,806 S448A probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Adgrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Adgrg3 APN 8 95039593 missense possibly damaging 0.90
IGL01724:Adgrg3 APN 8 95039425 missense probably benign 0.04
IGL02111:Adgrg3 APN 8 95034999 missense probably damaging 0.96
IGL02142:Adgrg3 APN 8 95039855 missense probably damaging 1.00
IGL02577:Adgrg3 APN 8 95039927 missense probably damaging 0.99
IGL02940:Adgrg3 APN 8 95033456 missense possibly damaging 0.48
IGL03395:Adgrg3 APN 8 95035073 missense probably damaging 1.00
R0111:Adgrg3 UTSW 8 95035110 splice site probably benign
R0288:Adgrg3 UTSW 8 95039940 missense possibly damaging 0.92
R0403:Adgrg3 UTSW 8 95036922 missense probably benign 0.07
R1553:Adgrg3 UTSW 8 95040268 missense possibly damaging 0.90
R1667:Adgrg3 UTSW 8 95033373 nonsense probably null
R1872:Adgrg3 UTSW 8 95033442 missense possibly damaging 0.87
R1882:Adgrg3 UTSW 8 95040315 missense probably benign 0.03
R1924:Adgrg3 UTSW 8 95035934 missense probably benign
R1998:Adgrg3 UTSW 8 95036668 missense probably damaging 1.00
R2090:Adgrg3 UTSW 8 95039930 missense possibly damaging 0.54
R2696:Adgrg3 UTSW 8 95021074 missense probably benign 0.01
R3846:Adgrg3 UTSW 8 95040421 missense probably benign 0.07
R4013:Adgrg3 UTSW 8 95035099 splice site probably benign
R4405:Adgrg3 UTSW 8 95036908 missense probably benign 0.15
R4622:Adgrg3 UTSW 8 95040525 missense probably damaging 1.00
R4878:Adgrg3 UTSW 8 95035086 missense possibly damaging 0.86
R5101:Adgrg3 UTSW 8 95036935 missense probably benign 0.00
R5309:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5312:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5353:Adgrg3 UTSW 8 95035928 missense probably damaging 0.99
R5820:Adgrg3 UTSW 8 95039593 missense possibly damaging 0.90
R6240:Adgrg3 UTSW 8 95039916 missense probably benign 0.23
R6272:Adgrg3 UTSW 8 95036261 missense noncoding transcript
R7110:Adgrg3 UTSW 8 95034963 missense possibly damaging 0.62
X0017:Adgrg3 UTSW 8 95017770 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- GGGTCAGTTCCCAAGTCGCTCTTC -3'
(R):5'- TCCCAGCATCCTGGCTGCTAAC -3'

Sequencing Primer
(F):5'- CTTTACCTTAAGAGCCCAGGGTC -3'
(R):5'- CTGACTGCAATGCTGCATAG -3'
Posted On2014-05-14