Incidental Mutation 'R1687:Washc2'
ID189417
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene NameWASH complex subunit 2`
SynonymsFam21, D6Wsu116e, C530005J20Rik
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116208038-116262686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116256712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 900 (S900T)
Ref Sequence ENSEMBL: ENSMUSP00000144703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000204283] [ENSMUST00000204476]
Predicted Effect probably benign
Transcript: ENSMUST00000036759
AA Change: S986T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: S986T

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203980
Predicted Effect probably benign
Transcript: ENSMUST00000204283
AA Change: S900T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104
AA Change: S900T

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204364
Predicted Effect probably benign
Transcript: ENSMUST00000204476
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204495
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116256676 missense probably benign
IGL00552:Washc2 APN 6 116256824 missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116247998 missense probably benign 0.44
IGL01668:Washc2 APN 6 116262338 missense probably damaging 1.00
IGL01982:Washc2 APN 6 116236189 missense probably benign 0.22
IGL02022:Washc2 APN 6 116259165 missense probably benign 0.22
IGL02150:Washc2 APN 6 116231632 splice site probably benign
IGL02224:Washc2 APN 6 116220569 missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116241610 missense probably damaging 0.98
IGL02555:Washc2 APN 6 116209100 missense probably damaging 1.00
IGL02612:Washc2 APN 6 116220616 missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116214018 splice site probably benign
IGL02900:Washc2 APN 6 116227474 missense probably damaging 1.00
IGL03263:Washc2 APN 6 116238123 splice site probably benign
fading UTSW 6 116254153 missense probably damaging 1.00
R0218:Washc2 UTSW 6 116248046 nonsense probably null
R0285:Washc2 UTSW 6 116221839 missense probably damaging 1.00
R0346:Washc2 UTSW 6 116220523 splice site probably benign
R0677:Washc2 UTSW 6 116244616 missense probably damaging 1.00
R0919:Washc2 UTSW 6 116208264 missense probably damaging 1.00
R1144:Washc2 UTSW 6 116224534 missense probably damaging 1.00
R1666:Washc2 UTSW 6 116223254 critical splice donor site probably null
R1702:Washc2 UTSW 6 116229306 missense probably damaging 0.99
R1740:Washc2 UTSW 6 116231632 splice site probably benign
R1952:Washc2 UTSW 6 116255091 missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116208987 missense probably damaging 0.99
R2039:Washc2 UTSW 6 116224439 missense probably damaging 0.99
R3084:Washc2 UTSW 6 116227493 missense probably benign 0.00
R3552:Washc2 UTSW 6 116220568 missense probably damaging 1.00
R3790:Washc2 UTSW 6 116247972 splice site probably benign
R3949:Washc2 UTSW 6 116208204 utr 5 prime probably benign
R4089:Washc2 UTSW 6 116256292 splice site probably null
R4133:Washc2 UTSW 6 116258930 missense probably damaging 0.99
R4258:Washc2 UTSW 6 116208241 missense probably damaging 1.00
R4510:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4511:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4613:Washc2 UTSW 6 116229269 missense probably damaging 1.00
R4614:Washc2 UTSW 6 116238174 missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116258649 missense probably benign 0.03
R5224:Washc2 UTSW 6 116209004 makesense probably null
R5367:Washc2 UTSW 6 116259150 missense probably damaging 1.00
R5602:Washc2 UTSW 6 116248095 missense possibly damaging 0.73
R6013:Washc2 UTSW 6 116254153 missense probably damaging 1.00
R6075:Washc2 UTSW 6 116227366 missense probably benign 0.02
R6086:Washc2 UTSW 6 116256216 splice site probably null
R6344:Washc2 UTSW 6 116258758 missense probably benign 0.08
R6592:Washc2 UTSW 6 116259249 missense probably damaging 1.00
X0018:Washc2 UTSW 6 116208258 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TTGATCCCAGTGATGGGCACAAG -3'
(R):5'- TGGGACATAACATGGTGACTGCAAG -3'

Sequencing Primer
(F):5'- CAAGTATGTGCCCCACTGAG -3'
(R):5'- CTGCAAGTATCTAATGATCAGCAGG -3'
Posted On2014-05-14