Incidental Mutation 'R1687:Ccm2'
ID189437
Institutional Source Beutler Lab
Gene Symbol Ccm2
Ensembl Gene ENSMUSG00000000378
Gene Namecerebral cavernous malformation 2
Synonyms
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1687 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6546887-6596744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6585118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 67 (R67G)
Ref Sequence ENSEMBL: ENSMUSP00000125608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000109721] [ENSMUST00000109722] [ENSMUST00000159007] [ENSMUST00000160633] [ENSMUST00000161501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000388
AA Change: R125G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378
AA Change: R125G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109721
AA Change: R61G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378
AA Change: R61G

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000109722
AA Change: R61G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378
AA Change: R61G

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000159007
AA Change: R67G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125608
Gene: ENSMUSG00000000378
AA Change: R67G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Blast:PTB 11 102 3e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000160633
AA Change: R119G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125072
Gene: ENSMUSG00000000378
AA Change: R119G

DomainStartEndE-ValueType
Blast:PTB 54 224 6e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000161501
AA Change: R91G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123790
Gene: ENSMUSG00000000378
AA Change: R91G

DomainStartEndE-ValueType
Blast:PTB 40 122 3e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die during embryonic development with vasculature defects in the heart and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Ppard A G 17: 28,297,180 Y126C probably damaging Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Ccm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Ccm2 APN 11 6594154 missense probably damaging 0.97
IGL02274:Ccm2 APN 11 6590808 missense probably damaging 1.00
IGL02946:Ccm2 APN 11 6596195 missense probably damaging 1.00
IGL02973:Ccm2 APN 11 6584544 missense probably damaging 1.00
R0521:Ccm2 UTSW 11 6590886 missense probably damaging 1.00
R1024:Ccm2 UTSW 11 6570119 nonsense probably null
R1201:Ccm2 UTSW 11 6593682 missense probably benign
R2199:Ccm2 UTSW 11 6590790 missense probably damaging 1.00
R3237:Ccm2 UTSW 11 6570090 missense probably benign 0.43
R5196:Ccm2 UTSW 11 6561181 utr 5 prime probably benign
R6954:Ccm2 UTSW 11 6594239 missense probably damaging 0.98
R7195:Ccm2 UTSW 11 6596302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAACCGAGGACTGTAGCCAGC -3'
(R):5'- AAGTCTCCAAAGGCCCTGAGTGTG -3'

Sequencing Primer
(F):5'- ACTGTAGCCAGCACAGTG -3'
(R):5'- CTAATTTATAGCCGTAGCAGGTG -3'
Posted On2014-05-14