Incidental Mutation 'R1687:Ppard'
ID189460
Institutional Source Beutler Lab
Gene Symbol Ppard
Ensembl Gene ENSMUSG00000002250
Gene Nameperoxisome proliferator activator receptor delta
SynonymsNr1c2, Pparb/d, PPAR-delta, Peroxisome proliferator-activated receptor beta, Pparb, NUC1, PPARdelta/beta
MMRRC Submission 039720-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R1687 (G1)
Quality Score127
Status Not validated
Chromosome17
Chromosomal Location28232754-28301469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28297180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 126 (Y126C)
Ref Sequence ENSEMBL: ENSMUSP00000133077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000169040]
Predicted Effect probably damaging
Transcript: ENSMUST00000002320
AA Change: Y126C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250
AA Change: Y126C

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Predicted Effect probably damaging
Transcript: ENSMUST00000169040
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133077
Gene: ENSMUSG00000002250
AA Change: Y126C

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable prenatal lethality and a range of phenotypes such as placental, brain, skin, hair follicle, adipose and lipid homeostasis abnormalities, growth retardation, reduced fertility, andincreased incidence of tumors/induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,888 F931I probably benign Het
Alox15 T A 11: 70,349,918 H212L probably benign Het
Arhgap42 A T 9: 9,035,537 V268D probably benign Het
Armc9 A G 1: 86,156,955 M1V probably null Het
BB287469 A G 12: 87,819,718 D133G unknown Het
Brca1 C T 11: 101,489,840 C1789Y probably benign Het
Cacng4 A G 11: 107,736,759 V138A probably benign Het
Camsap1 A G 2: 25,939,615 F699S probably damaging Het
Ccm2 A G 11: 6,585,118 R67G probably damaging Het
Cdk16 G A X: 20,696,659 probably null Het
Cep85 T C 4: 134,148,013 H546R probably benign Het
Cfap54 T C 10: 92,932,640 D207G probably damaging Het
Cldn9 G T 17: 23,683,076 R192S probably benign Het
Crybb3 A G 5: 113,079,767 S63P probably damaging Het
Cux1 A G 5: 136,312,669 L615P probably damaging Het
Dctn3 A G 4: 41,715,407 Y154H probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dnah3 A T 7: 120,045,786 probably null Het
Eml6 G A 11: 29,833,187 H565Y probably damaging Het
Ephb6 T C 6: 41,617,366 V610A probably benign Het
Fam234a T C 17: 26,215,308 Y333C probably damaging Het
Fbln1 G A 15: 85,227,106 V154I probably benign Het
Frem2 A T 3: 53,653,952 W1045R probably benign Het
Fubp1 A G 3: 152,228,201 probably benign Het
Gja3 T A 14: 57,036,876 N13I probably damaging Het
Gpr20 C A 15: 73,695,902 V213L probably benign Het
Grk5 T C 19: 61,076,783 I295T probably damaging Het
Gucy1b1 A G 3: 82,038,042 F430L probably damaging Het
Gzmk T A 13: 113,173,928 I119L probably benign Het
Hadh T C 3: 131,245,249 I153V probably benign Het
Hsfy2 T C 1: 56,636,853 Y175C probably damaging Het
Hspa5 T C 2: 34,775,824 I560T probably benign Het
Igdcc4 T C 9: 65,131,663 V863A probably damaging Het
Il22ra2 A G 10: 19,632,872 D216G probably benign Het
Klc2 G A 19: 5,111,654 P303S probably damaging Het
Lama5 C T 2: 180,194,066 V1192I probably benign Het
Mon2 A G 10: 123,026,124 S772P probably damaging Het
Mphosph8 T A 14: 56,672,478 L96Q probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nckap1 A G 2: 80,520,585 I726T probably damaging Het
Ndnf A T 6: 65,703,423 T229S probably benign Het
Npas3 A T 12: 54,048,875 probably null Het
Nrap C T 19: 56,355,529 E729K probably damaging Het
Nsun2 T A 13: 69,627,597 F387I probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pabpc1l C T 2: 164,044,306 T452M probably benign Het
Pcdh10 T C 3: 45,380,015 Y255H probably damaging Het
Pdcd6ip A T 9: 113,700,019 Y72N probably damaging Het
Pglyrp1 A T 7: 18,884,704 probably benign Het
Pkp2 T C 16: 16,268,709 probably null Het
Prkcq T C 2: 11,290,533 Y598H probably damaging Het
Rhobtb1 A G 10: 69,270,279 T287A probably damaging Het
Sema4b T C 7: 80,219,262 Y361H probably damaging Het
Slfn9 A T 11: 82,982,157 I640N probably damaging Het
Smurf2 C A 11: 106,836,070 probably null Het
Spag5 T C 11: 78,304,929 V354A probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
St6galnac5 C A 3: 152,981,250 L22F probably benign Het
Sugp2 T C 8: 70,242,634 S86P probably damaging Het
Tnk1 T C 11: 69,856,473 I111V possibly damaging Het
Tnni3k T A 3: 154,939,626 I541F possibly damaging Het
Trim36 G T 18: 46,188,657 H108N possibly damaging Het
Ttn T C 2: 76,870,907 probably benign Het
Usp28 T A 9: 49,024,017 S89R probably benign Het
Vmn2r121 T C X: 124,132,791 D223G probably benign Het
Vmn2r65 T A 7: 84,940,818 Y630F probably benign Het
Washc2 T A 6: 116,256,712 S900T probably benign Het
Wdr72 A G 9: 74,210,199 N731S probably benign Het
Xrra1 T A 7: 99,876,244 F123L probably damaging Het
Zfp648 A G 1: 154,204,242 D49G probably benign Het
Other mutations in Ppard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Ppard APN 17 28298903 missense probably damaging 1.00
IGL02023:Ppard APN 17 28298897 missense probably benign
IGL03027:Ppard APN 17 28299791 missense possibly damaging 0.68
R1785:Ppard UTSW 17 28298481 critical splice donor site probably null
R1791:Ppard UTSW 17 28286374 missense unknown
R1832:Ppard UTSW 17 28297110 missense probably benign 0.01
R2062:Ppard UTSW 17 28299689 missense probably damaging 1.00
R4732:Ppard UTSW 17 28286443 missense probably benign
R4733:Ppard UTSW 17 28286443 missense probably benign
R4801:Ppard UTSW 17 28286374 missense unknown
R4802:Ppard UTSW 17 28286374 missense unknown
R4803:Ppard UTSW 17 28286374 missense unknown
R5252:Ppard UTSW 17 28298848 missense probably benign
R5305:Ppard UTSW 17 28298858 missense probably damaging 1.00
R6572:Ppard UTSW 17 28297119 nonsense probably null
R7060:Ppard UTSW 17 28298912 missense probably benign 0.00
R7098:Ppard UTSW 17 28298813 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTGTGACCTTACGTGCCACTGGG -3'
(R):5'- TGGGCTTGTCACTTGAAGCAGAAC -3'

Sequencing Primer
(F):5'- CGTGCCACTGGGCTCTG -3'
(R):5'- GGCATTTGTATCAGCCATCAACAG -3'
Posted On2014-05-14